Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 6 NITRO 1 PHENYL 1H INDAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-acetylated tubulin clone 6-11B-1 (1:500, Sigma-Aldrich, T6793), mouse anti-gamma tubulin GTU-88 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-acetylated tubulin at 1:1000 (6-11B-1, Sigma-Aldrich). Fluorescent secondary antibodies conjugated to AlexaFluor488 and AlexaFluor564 were used at 1:500 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-acetylated tubulin (Sigma-Aldrich, clone 6-11B-1, 1:1000) rabbit polyclonal anti-POC5 (A303-341A-T ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-acetylated α-tubulin (1:2,000; 6–11B-1; Sigma-Aldrich T6793), rat anti–E-cadherin (1:1,000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma-Aldrich) was used for nuclei staining and added to the secondary antibody solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:1000; Sigma) was used as nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... LC separation was performed on an Ascentis Express phenyl-hexyl column (100 × 2.1 mm, 2.7 μm; Sigma-Aldrich) with solvent A (HPLC-grade water + 0.1% Formic acid ...
-
bioRxiv - Bioengineering 2023Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5 kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A total of 150 µL of 3% 4-ethoxymethylene-2-phenyl-2-oxazolin-5-one (oxazolone; Sigma-Aldrich) dissolved in 100% ethanol (Wako ...
-
bioRxiv - Bioengineering 2023Quote: ... Hydrogels for stiffening experiments were swelled in phosphate buffered saline (PBS; HyClone) with 2.2 mM lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP; Sigma-Aldrich) photoinitiator overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 µm 6,7-Dinitroquinoxaline-2,3(1H,4H)-dione (DNQX, Sigma-Aldrich, D0540) were used to isolate mEPSCs or mIPSCs ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by blocking for 1h at room temperature (5% Donkey Serum (D9663, Sigma) in 0.3% PBS-Tween (Tween 20 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then blocked for 1h in 10% goat serum in TBS (Sigma-Aldrich). For IF ...
-
bioRxiv - Genetics 2020Quote: ... for 1h at 56°C and then alkylated with 5mM iodoacetamide (Sigma-Aldrich) for 45 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... PBS pH 7.2) at RT for 1h and incubated with Acta2 antibody (Sigma) at 40C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... 24h later at least 1h at RT and stained with crystal violet (Sigma). PFU were counted from each dilution in order to determine the infectious titer (in PFU/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1h at 56°C and then alkylated with 5mM iodoacetamide (Sigma-Aldrich) for 45 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were blocked 1h at 4°C in PBS + 0.1% BSA (Sigma; #A2058), 0.2% Triton X-100 + 0.1% Tween20 ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... Membrane was blocked for 1h in 5% BSA (bovine serum albumin, Sigma-Aldrich) in Tris-buffered saline with 0.1% Tween® 20 detergent (TBST ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Membranes were blocked (1h) with bovine serum albumin (5% wt/vol, Sigma-Aldrich) in Tris-buffered saline with Tween-20 (0.1%) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Thapsigargin ((3S,3aS,4R,6R,7S,8R)-6-acetoxy-4-(butyryloxy)-3,3a-dihydroxy-3,6,9-trimethyl-8-(((Z)-2-methylbut-2-enoyl)oxy)-2-oxo-2,3,3a,4,5,6,6a,7,8,9b-decahydro-1H-cyclopenta[e]azulen-7-yl octanoate) from Sigma was dissolved in DMSO to a stock concentration of 5 mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrates (Sigma-Aldrich) in NTM (100mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and the blotting signals were chemically visualized with either the nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP) chromogenic assay (Sigma) or infrared scanner ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4) the substrate solution (nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, Sigma-Aldrich, St. Louis, MO). Other details were as described previously [Duk M. ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
bioRxiv - Cell Biology 2021Quote: ... the droplets were removed and replaced with an equal volume of 0.1% Nitro blue tetrazolium (NBT; Sigma-Aldrich, Darmstadt, Germany) solution ...
-
bioRxiv - Bioengineering 2021Quote: ... slides were either treated with SIGMA FAST™ BCIP/NBT (5-Bromo-4-chloro-3-indolulphosphate/Nitro blue tetrazolium, pH 9.5, Sigma) and counterstained with nuclear fast red (Sigma ...
-
bioRxiv - Systems Biology 2022Quote: ... of 5,5’dithiobis-2-nitrobenzoic acid conversion to 2-nitro-5-thiobenzoic acid in the presence of Coenzyme A thiol generated during citrate production (CS0720, Sigma) as previously described.62