Labshake search
Citations for Millipore Sigma :
5401 - 5450 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... then were pretreated with TRIS containing 1-3% bovine serum albumin (Sigma) and 0.1-0.3% Triton-X depending on the detectable target protein ...
-
bioRxiv - Physiology 2020Quote: ... and were purchased from Sigma-Aldrich (see Table 3 for primer details). All reactions were performed in duplicate on 384-well MicroAmp optical plates (Applied Biosystems ...
-
bioRxiv - Biophysics 2020Quote: ... and 1 μg/μL Laminin (3 h at 37°C) (Sigma Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... 20 μL of aqueous 3% H2O2 solution (Sigma-Aldrich, St. Louis, MO) was then pipetted onto 6-mm diameter disk ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX) (Sigma, Germany #28822-58-4). After 48 h the induction medium was replaced by the differentiation medium containing DMEM/Ham’s F12 ...
-
bioRxiv - Biophysics 2020Quote: ... We let the coverslips dry and added (3-aminopropyl) triethoxysilane (APTES, Sigma) to their treated sides afterwards ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Sigma-Aldrich) for the MTT assay was dissolved in PBS in stock concentration 5 mg/mL and stored at 4 °C in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 μM Arp2/3 inhibitor CK-666 (MERCK Millipore, #182515-25MG) both confined and unconfined cells were incubated with the drugs for two hours before imaging was started ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tissue sections were then incubated in blocking buffer [3% Goat Serum (Sigma), 1% Bovine Serum Albumin (Sigma) ...
-
bioRxiv - Systems Biology 2022Quote: ... Vancomycin (Sigma Aldrich, Louis, MO, USA; 0, 3, 10, 30, 100 µM) was incubated with EPEC strains at 37?C ...
-
bioRxiv - Microbiology 2022Quote: ... Suspensions were then incubated with 3% w/v mutanolysin (Sigma-Aldrich, M9901) for 1 hour at 370C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 16.7mM glucose + 100μM 3-isobutyl-1-methyl-xanthine (IBMX, Sigma, Cat #: I5879), 16.7mM glucose + 20mM Arginine/HCl (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Biotin 3-sulfo-N-hydroxysuccinimide ester (1 mg/mL; Sigma, Cat# B5161) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Virus amplification was performed in Sf9 TriEX cells (Novagen / Merck #71023-3) grown in TriEx media (Novagen / Merck #71022) ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed 3 times in 1X Phosphate Buffered Saline (PBS, Sigma-Aldrich, P5493) and stored at 4°C in PBS supplemented with 0.1% Sodium Azide (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... Following 3 washes with TBS-t membranes were developed with Luminol (Sigma) in the ImageQuant LAS4000 system ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3 mL LB starter culture with 100 μg/mL carbenicillin (Sigma) was prepared from a single fresh colony and grown for 4 hours at 37° C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Inactivation of endogenous peroxidases was carried out using 3% hydrogen peroxide (Sigma) for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The lysate was then treated with Benzonase nuclease HC (#71206-3, Millipore) for 45 minutes at 37 oC ...
-
bioRxiv - Pathology 2022Quote: ... The lysate was then treated with Benzonase nuclease HC (#71206-3, Millipore) for 45 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3% dextran (Leuconostoc spp, Mr 450,000-650,000, Sigma-Aldrich, St. Louis, MO) in PBS (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: 2’-3’-dideoxycitidine (ddC) was purchased from Sigma Aldrich (St. Louis, MO). AM1710 was synthesized by the lab of Alexandros Makriyannis (Northeastern University ...
-
bioRxiv - Biochemistry 2022Quote: ... The second layer was coated with 3-aminopropyl trimethoxysilane (Sigma-Aldrich, USA) for 2 h ...
-
bioRxiv - Biophysics 2022Quote: ... Anti-YB-3 (Anti-YBX3 antibody produced in rabbit, HPA034838, Sigma-Aldrich) and Anti-HuR (antibody produced in mouse (3A2) ...
-
bioRxiv - Cell Biology 2022Quote: ... drug selection was performed with 3 μg/mL puromycin (Sigma-Aldrich, P8833). Puromycin-resistant cells were passaged 3 times and then sorted by flow cytometry (Sony ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Developmental Biology 2022Quote: ... a 400x stock solution of 3-indoleacetic acid (auxin, Sigma Aldrich, I2886) in 100% ethanol was prepared ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing phosphatase inhibitor cocktails 2 and 3 and protease inhibitors (Sigma-Aldrich), for 30–45min at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 400μL (3 mg/mL) of methylbenzothiazolinone-2-hydrazone (MBTH, Sigma M8006−1G), 200μL of sample and 0.5μI of alcohol oxidase (E.C ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Millipore 71842-3) using primers KL207/KL200 for the sfgfp gene and primers BAC338F/BAC805R for the 16S rRNA gene48.
-
bioRxiv - Immunology 2021Quote: Peptides with predicted binding to DR0401 (Supplemental Table 3) were synthesized (Sigma) and their binding to DR0401 was assessed through a competition assay ...
-
bioRxiv - Neuroscience 2021Quote: ... Ovaries were treated with collagenase (3 mg/ml, Sigma-Aldrich Chemie GmbH) in OR2 solution (NaCl 82.5 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane strips were blocked with 3% fatty acid free BSA (Sigma Aldrich) and then incubated with 100 nM recombinant His-tagged WT/R47H TREM2 ECD diluted in blocking buffer at 4°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... followed by two washes with 1xPBS and blocking with 3% BSA (Sigma) for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... For certain experiments cells were treated with 3 μM vorinostat (SAHA, Sigma) or 0.5% DMSO (vehicle control ...
-
bioRxiv - Immunology 2020Quote: Selected LNs were embedded in 3% low melting temperature agarose (Sigma-Aldrich), and then sliced into 350 µm-thick sections using a vibratome ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae were next washed 3 times in PBS1X + 0.3% triton (Sigma T8787) for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated overnight in rabbit anti-GluR2/3 (AB1506, Millipore Sigma, Burlington ...
-
bioRxiv - Developmental Biology 2022Quote: ... rinsing in PBS containing 3 mg/mL polyvinylpyrolidone (PBS/PVP; P0930, Sigma), permeabilized in PBS/PVP containing 0.25% Triton X-100 (23,472-9 ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mM MgCl2) supplemented with complete Protease inhibitor cocktail tablets (Sigma- Aldrich). The lysates were incubated on ice for 1 hour and centrifugated at 20,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 3 times and then reduced with 500 μL 10 mM DTT (Sigma) in PBS for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were blocked in 3% normal goat serum (Sigma, St Louis, MO) for 1h ...
-
bioRxiv - Immunology 2022Quote: ... Anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody clone 6C5 (Merck Millipore, MAB374) was used as control antibody ...
-
bioRxiv - Developmental Biology 2022Quote: ... supplemented with 0.2 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma-Aldrich, I5879). The ovarian follicles were punctured with a syringe needle ...
-
bioRxiv - Cell Biology 2022Quote: ... Ovaries were digested using 3 mg/ml Collagenase IA (Sigma, C9891-1G) in MMR by gentle rocking until dissociated oocytes were visible ...
-
bioRxiv - Cell Biology 2022Quote: ... or the YAP inhibitor verteporfin (0.5 μM; Sigma-Aldrich; for 3 d).
-
bioRxiv - Developmental Biology 2022Quote: ... 0.08% tricaine (Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, cat. no. E10521-50G), 0.008% tetramisole hydrochloride (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... via N – (3-Dimethylaminopropyl)-N ′ - ethylcarbodiimide (EDC)/N-Hydroxysuccinimide (NHS) (Sigma-Aldrich) mediated coupling ...