Labshake search
Citations for Millipore Sigma :
5251 - 5300 of 10000+ citations for St Louis Encephalitis virus lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: All chemicals and media ingredients were purchased from Sigma-Aldrich (St. Louis, U.S.A.) or from Carl Roth GmbH (Karlsruhe ...
-
bioRxiv - Physiology 2019Quote: ... The different agonists and CDCA were purchased from Sigma-Aldrich (St. Louis, MO).
-
bioRxiv - Genetics 2019Quote: ... and alkylated with 55 mM iodoacetamide (Sigma-Aldrich, St. Louis, MO, product I11490). Proteins were digested for 18 hr at 37 °C in 2 M urea 100 mM Tris pH 8.5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were fixed with 4% paraformaldehyde paraformaldehyde (Sigma-Aldrich Corp. St. Louis, MO) at room temperature for 0.5 h and stained with 0.1% crystal violet solution (Sigma-Aldrich Corp ...
-
bioRxiv - Physiology 2019Quote: ... digitonin and protease inhibitor were obtained from Sigma Aldrich (St. Louis, MO, USA). Hydrogen peroxide is from Fluka (Buchs ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were cultured in Dulbecco’s Eagle’s medium (DMEM; Sigma, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (HyClone ...
-
bioRxiv - Neuroscience 2019Quote: (-)-Oxycodone HCl and (-)-naloxone HCl were obtained from Sigma-Aldrich (St. Louis, MO). SR141716 was purchased from Cayman Chemical ...
-
bioRxiv - Immunology 2019Quote: ... BMDM were pre-treated with LPS (100ng/mL, Sigma Aldrich, St. Louis, MO) and rIFNγ (100ng/mL ...
-
bioRxiv - Immunology 2020Quote: ... Methly-β-cyclodextran (MβCD) was purchased from Sigma-Aldrich (St. Louis, MO, USA). All specific inhibitors for MAPKs were obtained from Calbiochem (La Jolla ...
-
bioRxiv - Physiology 2019Quote: ... and a cocktail of protease inhibitors (Sigma, St Louis, MO, USA, Cat# P0044). Protein concentration were measured with Quick StartTM Bradford Dye Reagent (BIO-RAD) ...
-
bioRxiv - Immunology 2019Quote: ... 10% fetal calf serum (Gibco, New Zealand and Sigma-Aldrich, St. Louis, USA), and Penicillin-Streptomycin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 50 mg/L ascorbic acid (Cat # A454425G, Sigma Aldrich, St Louis, MO). Pulmonary arterial smooth muscle cells (PASMCs ...
-
bioRxiv - Microbiology 2019Quote: ... and CRISPR negative controls were purchased from Sigma (Sigma-Aldrich; St Louis, MO). The CRISPR system consisted of 3 gRNA sequences (CCACCTGAAGTTGACTCAGGTA ...
-
bioRxiv - Physiology 2019Quote: ... All the other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated.
-
bioRxiv - Molecular Biology 2019Quote: ... mice were intraperitoneally injected with Tamoxifen (1 mg/kg, Sigma, St Louis, MO) for five subsequent days to induce Cre expression and gene excision ...
-
bioRxiv - Pathology 2020Quote: Kidney mitochondria were isolated using the kit (MITOISO1) from Sigma (St. Louis, MO) according to manufacturer instructions.
-
bioRxiv - Plant Biology 2019Quote: ... Sodium chloride (NaCl, purity ≥ 99.5%) was purchased from Sigma-Aldrich (St. Louis, Missouri).
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted with Tri-Reagent (Sigma-Aldrich, St. Louis, MO, USA) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and detected using monoclonal antipoly histidine primary antibodies (Sigma-Aldrich, St. Louis, MO) coupled with anti-mouse IgG alkaline phosphatase conjugate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... All other reagents unless mentioned were supplied by Sigma-Aldrich (St. Louis, MI).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Perfluorooctanoic acid (cat. # 171468, 95% pure) was from Sigma-Aldrich (St. Louis, MO). All other reagents were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with Complete Protease Inhibitor Cocktail (Cat# 04693132001, Sigma Inc. St. Louis, MO) and PhosStop (Cat#4906845001 ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 cells were transfected using Polyethylenimine (PEI,Sigma Aldrich; St. Louis, Missouri, USA). PEI and vector media were combined in a ratio of 5µL PEI and 0.5µg vector in 250µL of serum-free DMEM and incubated for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... and Masson’s trichrome using reagents and kits from Sigma (Sigma, St. Louis, MO) following standard protocols ...
-
bioRxiv - Developmental Biology 2020Quote: Fish were anesthetised by immersion in 0.04% tricaine (Sigma-Aldrich, St Louis, MO) in fish water and placed on a wet sponge under a stereoscope with the ventral side exposed ...
-
bioRxiv - Cell Biology 2020Quote: ... mice were treated with 1 mg/kg tamoxifen (Sigma-Aldrich, St Louis, MO) via intraperitoneal injection every day for 5 total injections to induce Cre expression and gene excision ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 100 units/ml penicillin/streptomycin (PenStrep®, Sigma-Aldrich, St. Louis, MO). The cells were seeded one or two days prior to experiments ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... (E)-2-decenal were all obtained from Sigma-Aldrich (St. Louis, Missouri, USA). Dopamine was obtained from Tocris Bioscience (Bristol ...
-
bioRxiv - Biochemistry 2020Quote: ... 65 (POPG) in 25 mM Na-cholate (Sigma-Aldrich, St. Louis, MO, USA), 50 mM Tris ...
-
bioRxiv - Microbiology 2019Quote: ... and 0.25 units JumpStart Taq DNA polymerase (Sigma-Aldrich, St. Louis, MO, USA). PCR primers 515F (GTGCCAGCMGCCGCGGTAA ...
-
bioRxiv - Developmental Biology 2020Quote: ... counter-stained with 10µg/mL Hoechst 33342 (Sigma-Aldrich, St. Louis, MO, USA), post-fixed in 4% formaldehyde/PBS-T and stored at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... ionomycin (I9657) and tunicamycin (T7765) were purchased from Sigma (St. Louis, MO, USA) and prepared in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... NaOH and Na2HPO4 have been purchased from Sigma-Aldrich (St. Louis, Missouri, USA). PBS (phosphate buffer saline ...
-
bioRxiv - Neuroscience 2020Quote: ... and β-actin (1:10,000; a1978-200UL, Sigma-Aldrich, St. Louis, MO, USA), diluted in TBST with 1% skim milk ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Geraniol (163333) and UDP-glucose (94335) were purchased from Sigma (St. Louis, MO) and cis-trans-nepetalactol from Santa Cruz Biotech (sc-506178) ...
-
bioRxiv - Systems Biology 2021Quote: ... Mass spectrometry-grade formic acid was purchased from Sigma-Aldrich (St Louis, MO). Metabolite standards and internal standards for assays include trans-zeatin (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2020Quote: ... The triphenyltetrazolium chloride (TTC) was purchased from Sigma-Aldrich (St. Louis, MO, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... which included 6% rabbit serum (complete media from Sigma-Aldrich, St. Louis, Missouri) at 33°C.
-
bioRxiv - Plant Biology 2021Quote: ... Anti-FLAG (F3165, Monoclonal ANTI-FLAG® M2, Millipore Sigma, St. Louis, MO), Anti-FRB (ALX-215-065-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected N-methyl-D-aspartic acid (NMDA) (Sigma-Aldrich; St. Louis, MO) intravitreally (52) ...
-
bioRxiv - Bioengineering 2019Quote: ... the molds were silanized by exposure to trichloromethlysilane (Sigma-Aldrich, St. Louis, MO) vapor under vacuum for 20 min ...
-
bioRxiv - Cell Biology 2019Quote: ... protease inhibitor mixture and phosphatase inhibitor mixture (Sigma-Aldrich, St Louis, MO, USA). Whole cell lysates obtained from the supernatant after microcentrifugation at 14,000 rpm for 15 min at 4°C were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Cell Biology 2019Quote: ... D-glucose (2 g/kg body weight) (Sigma-Aldrich, St Louis, MO, USA) was intraperitoneally injected into male mice that had fasted overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... Bovine serum albumin (BSA) was purchased from Sigma Aldrich (St. Louis, MO, USA).
-
bioRxiv - Pathology 2020Quote: UC MSCs were labeled with fluorescent PKH26 (Sigma-Aldrich, St Louis, MO, USA) according to the manufacturer’s protocol that is known to have an in vivo half-life of greater than 100 days and would be useful for in vivo cell trafficking(34) ...
-
Orange is the new white: taxonomic revision of Antarctic Tritonia species (Gastropoda: Nudibranchia)bioRxiv - Zoology 2020Quote: ... 3.3 μL REDExtract-N-Amp PCR ReadyMix (Sigma Aldrich, St. Louis, MO, USA), 0.3 μL of each primer ...
-
bioRxiv - Plant Biology 2019Quote: ... the samples were embedded in Paraplast Plus (Sigma-Aldrich, St. Louis, MO, USA). Cross sections of thickness 15 µm were mounted on poly-L-lysine-treated slides (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... dimethyl sulfoxide (DMSO) and ethanol were purchased from Sigma-Aldrich (St. Louis, MO) and Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Physiology 2020Quote: ... and purified using GenElute Mammalian Genomic DNA Miniprep (Sigma-Aldrich, St. Louis, MO), and 200 ng DNA were used to analyze KRAS codon 12/13 and 61 mutations with ddPCR KRAS G12/G13 and KRAS G61 Screening Kits and QuantaSoft Analysis Pro software (Bio-Rad ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... mice were injected intraperitoneally with 300mg/kg Bromodeoxyuridine (BrdU, Sigma, St. Louis, Missouri) and sacrificed 4 hours after the injection ...