Labshake search
Citations for Millipore Sigma :
5251 - 5300 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... incubated at 4°C O/N with primary α-FLAG (Millipore F1804-5MG) or α- beta-Actin (Abcam ab8224 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rewashed and mounted using antifade (0.2% N-propyl gallate in 75% glycerol; Sigma). The fluorescence was visualized under an Echo-Revolve fluorescence microscope at a magnification of 200X ...
-
bioRxiv - Microbiology 2020Quote: ... N-linked glycans were purified on a Nafion® 117 membrane (Sigma-Aldrich) prior to injection ...
-
bioRxiv - Immunology 2020Quote: ... Cultures were run in triplicate in EliSpot multiwell plates (Millipore, cat n. MSPS4510) pre-coated with the AN18 mAb against mouse IFN-γ (Mabtech ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM N-ε-acetyl-lysine (Sigma-Aldrich Co., St. Louis, MO), to ensure that this non-canonical amino acid did not limit the expression of the Ac-K atACS variant ...
-
bioRxiv - Genomics 2022Quote: ... we gently denatured the histones by treating with 0.1 N HCl (Sigma H9892) diluted in water for 5 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... mouse monoclonal IgG2aĸ antibody with epitope matching the N-terminus (EMD Millipore #MABS1920), nuclear matrix protein p84 [EPR5662(2)] rabbit monoclonal antibody mapping with aa350-450 (abcam #ab131268) ...
-
bioRxiv - Systems Biology 2022Quote: ... A 1-hour pretreatment with 2mM N-acetyl cysteine (NAC; Sigma-Aldrich, A9165) was accomplished by addition to all staining ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich).
-
bioRxiv - Microbiology 2022Quote: ... Parasites were grown to >4% parasitaemia when 50 mM N-Acetylglucosamine (Sigma Aldrich) was added to the culture to eliminate asexual stages ...
-
bioRxiv - Biochemistry 2024Quote: ... Fresh stocks of the monovalent reagents N-(propionyloxy)succinimide ester (PropNHS, Sigma-Aldrich), Biotin-X-NHS (Biotin-NHS ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing N-WASP were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) and further purified by size exclusion chromatography using a Superdex 200 prepgrade column (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... coverslipped using a mounting media solution of 0.5% N-propyl gallate (Sigma-Aldrich) and 90% glycerol in ddH2O ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: Snap-frozen placental samples (n=25) were lyzed in TRI Reagent (Sigma-Aldrich) using the RETCH MM 400 Mixer Mill (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... β-hexosaminidase substrate (4-nitrophenyl N-acetyl-β-D-glucosaminide, 4 mM, Sigma) was then added to the supernatant and lysate for 1 h at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: WT and emx2el586/el586 heterozygous incrosses were incubated in 0.003% N-Phenylthiourea (Sigma). At 48 hpf ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received intraperitoneal injections of clozapine-N-oxide (CNO, Sigma, dissolved in saline) 10 minutes prior to the resident-intruder test.
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Biochemistry 2023Quote: ... Negative control samples were prepared using 10 mM N-ethymaleimide (NEM, Sigma-Aldrich) instead of mPEG ...
-
bioRxiv - Physiology 2023Quote: ... DNA extraction was done using REDExtract-N-Amp Tissue PCR kit (XNAT, Sigma). For the PCR reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... culture medium consisting of advanced DMEM/F12 supplemented with N-Acetylcysteine (Sigma-Aldrich), B plus supplement (bioGenous) ...
-
bioRxiv - Biophysics 2023Quote: ... sodium chloride and trimethylamine N-oxide (TMAO) were all purchased from Sigma-Aldrich as previously reported (15,18-23) ...
-
bioRxiv - Microbiology 2023Quote: ... E and/or N in the presence of 5 μg/ml polybrene (Millipore). 1 ml of each undiluted vector preparation was used for transduction of cells plated in one well ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were coated in Fibronectin (40µg/ml – ref. n°F1141 Merck/Sigma-Aldrich). WM1862 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-(N-Ethyl Carboxamide) adenosine (NECA) was purchased from Sigma-Aldrich (Cat. #119140), dissolved in DMSO to 10 mM stock ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Primary antibodies used for immunofluorescence were rabbit anti CCDC15 (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further derivatized with 10 μL tert-butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma, 394882) and incubating at 70°C for 60 minutes.
-
bioRxiv - Microbiology 2023Quote: ... N-acetyl glucosamine (GlcNAc) provided by Sigma (Cas 7512-17-6, PN A4106).
-
bioRxiv - Bioengineering 2023Quote: ... Cell pellet was collected and suspended in N-Ethylmaleimide (NEM) solution (Sigma Aldrich), and the resulting cell suspension was precipitated ...
-
bioRxiv - Biochemistry 2023Quote: ... Sensitivity to NO-inducing agents S-nitroso-N-acetyl penicillamine (SNAP) (N3398, Sigma) and Z)-1-[2-(2-Aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA/NONOate ...
-
bioRxiv - Physiology 2023Quote: ... and plasma insulin (n=5) was analyzed by ELISA (EZRMI-13K, Sigma Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... in 50 mM of 2-(N-morpholino)ethanesulfonic acid (MES, Sigma-Aldrich Inc.) buffer (pH = 6) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Male mice (n=25) were gavaged with tideglusib or 26% peg-400 (Sigma), 15% Cremophor EL (Sigma) ...
-
bioRxiv - Biophysics 2024Quote: ... A stock solution was made of 1M N-ethylmaleimide (NEM; Sigma-Aldrich, USA) dissolved in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... The N-terminal hexahistidine tag was cleaved with ∼2 units of thrombin (Sigma) per 1 mg of protein ...
-
bioRxiv - Developmental Biology 2024Quote: ... specifically N-[2-(p-Bromocinnamylamino) ethyl]-5-isoquinolinesulfonamine dihydrochloride (H89, B1427, Sigma-Aldrich), were utilized in this study.
-
bioRxiv - Cell Biology 2024Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Anti-CCDC66 antibody was generated by immunizing rats (Koc University ...
-
bioRxiv - Neuroscience 2024Quote: ... dechorionated at 24 hpf and incubated with 0.3% N-phenylthiourea (PTU; Sigma-Aldrich) to inhibit melanogenesis ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotyping was conducted with RED Extract-N-Amp (Sigma-Aldrich, St. Louis, MO) using primers R1965 5′ GCT CAA GGT TGT ATG CCT TGG TGC T 3′ ...
-
bioRxiv - Biochemistry 2024Quote: ... with an N-terminal Myc-DKK tag and pETDuet-1 (Sigma-Aldrich, 71146) were used for expression in mammalian cells and bacteria ...
-
bioRxiv - Biochemistry 2024Quote: ... and 12.5 µl of 4-methylumbelliferyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) was incubated for 15 minutes at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the lysates were supplemented with 20 mM N-ethylmaleimide (NEM; E3876, Sigma-Aldrich) and mixed with loading buffer without β-mercaptoethanol ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3-dpf larvae were anesthetized with 0.016 % Tricaine/Ethyl 3-aminobenzoate methanesulfonate salt (A5040, SIGMA-ALDRICH) and microinjected with 5-8 nL of liposome encapsulated clodronate (SKU# CLD-8909 ...
-
bioRxiv - Bioengineering 2021Quote: ... scaffolds were rehydrated in PBS overnight with 1-ethyl-3-(3- dimethylaminopropyl) carbodiimide (EDAC, Sigma-Aldrich) and N- hydroxysuccinimide (NHS ...
-
bioRxiv - Microbiology 2019Quote: ... EVs were incubated with Gal-3 (Gal-3 human recombinant, expressed in E. coli, Sigma-Aldrich) at different final concentration (0 to 10 µg/ml) ...
-
bioRxiv - Plant Biology 2021Quote: ... Roots samples were vacuum infiltrated with 3-3’-diaminobenzidine tetrahydrochloride (1.25 mg/mL, DAB, Sigma-Aldrich), Tween-20 (0.05% v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA was fixed by using 1-ethyl-3-[3- dimethylaminopropyl] carbodiimide hydrochloride (EDC, Sigma-Aldrich) for 1 h at 60°C ...
-
bioRxiv - Pathology 2024Quote: ... concentrated 10 times using Amicon Ultra-4 Ultracel-3 3 kDa centrifugal filter units (Millipore, UFC800308). Aliquots of concentrated medium and flowthrough medium were frozen at −80°C.
-
bioRxiv - Pathology 2024Quote: ... concentrated 10 times using Amicon Ultra-4 Ultracel-3 3 kDa centrifugal filter units (Millipore, UFC800308). Aliquots of concentrated media and flowthrough media were frozen at −80°C.
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...