Labshake search
Citations for Millipore Sigma :
5201 - 5250 of 10000+ citations for Ceramide Synthase 3 CERS3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.5 μL of the quenched reaction mixture was mixed with 3 μL of P1 nuclease (Sigma) (≥0.01 U/μL in 300 mM NaOAc pH 5.0 and 0.15 mM ZnCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... centrifuged at 3500 × g for 30 min followed by a 3 kDa spin filter (2ml, Millipore) twice at 10000 × g for 30 min and finally washed with urea buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... the resulting TCO-containing enzymes were extracted using a 3 kDa cutoff centrifuge filter (Millipore-Sigma) by centrifugation (Eppendorf 5430R ...
-
bioRxiv - Biochemistry 2021Quote: ... the resulting TCO-containing enzymes were extracted using a 3 kDa cutoff centrifuge filter (Millipore-Sigma) by centrifugation (Eppendorf 5430R ...
-
bioRxiv - Biochemistry 2021Quote: ... and the (DE3) lysogen was made using the λDE3 Lysogenization Kit 538 (EMD Millipore #69734-3). Expression was performed as described above apart from chloramphenicol being used with Lemo strains ...
-
bioRxiv - Neuroscience 2021Quote: ... and the cells were permeabilized and blocked with a 3% bovine serum albumin (BSA) (Sigma-Aldrich) 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis assay of U87-MG treated cells was measured using the Caspase-3 assay kit (Sigma). The Caspase-3 colorimetric assay is based on the hydrolysis of acetyl-Asp-Glu-Val-Asp p-nitroanilide (Ac-DEVD-pNA ...
-
bioRxiv - Cell Biology 2019Quote: ... shRNA specific for hERG1b 5’-CCACAACCACCCTGGCTTCAT-3’ and its respective control were purchased from Sigma-Aldrich. For heterologous expression ...
-
bioRxiv - Cell Biology 2020Quote: ... Bead solution on the column was incubated with 3 µL 50U Thrombin (EMD Millipore, Novagen®) in 250 µL wash buffer overnight at 4° C on a rotator ...
-
bioRxiv - Cell Biology 2019Quote: Purified Wss1 wildtype (3.1 μM) or various mutant alleles (3 μM) were incubated with ssDNA (Sigma) (5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
bioRxiv - Bioengineering 2020Quote: ... PEDOT:PSS (PH1000, Clevios Heraeus) was mixed to 0.1 v/v% (3-glycidyloxypropyl)trimethoxysilane (440167, Sigma Aldrich), filtered (1 μm PTFE filters) ...
-
bioRxiv - Immunology 2020Quote: ... larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich). Simple tail transection of the caudal fin was performed using surgical blade (Feather ...
-
bioRxiv - Microbiology 2021Quote: ... A carboxylated indene standard (1H-Indene-3-carboxylic acid) was purchased from Sigma-Aldrich (catalog #MNO000013). Hexanes and acetone (Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... Tumours were then transferred to digestion medium composed of 3 mg/ml collagenase A (Sigma, 10103586001) and 25 μg/ml DNAse I (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The Netherlands) at 37 °C with 100 μM Sodium 3-(3,4-dihydroxyphenyl)-DL-lactate (39363,Sigma). Samples were taken at 0 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2019Quote: Full-length IN and CCD sequences derived from pNL4-3 were introduced to pET30a vectors (Novagen) with Hisx6 tagged at the C-terminus or N-terminus ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6J mice were intraperitoneally injected with 1 ml of 3% Brewer thioglycollate medium (Sigma-Aldrich). Elicited peritoneal neutrophils and macrophages were collected 1 day and 3 days after the injection ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 KDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C at 12,000 g ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 minutes at 4°C at 12,000 g ...
-
Disparate regulation of imd drives sex differences in infection pathology in Drosophila melanogasterbioRxiv - Immunology 2020Quote: ... 3 flies were homogenised in 100μl of the single-step RNA isolation reagent TRI Reagent (Sigma), followed by a chloroform extraction and precipitation in isopropanol ...
-
bioRxiv - Immunology 2021Quote: ... dibutyryl cyclic adenosine monophosphate (db-cAMP) and 3-isobutyl-1-methyxanthine (IBMX) were purchased from Sigma. Complete RMPI consisted of RPMI 1640 (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... and blocked for at least an hour at 4° in PBST + 3% normal goat serum (Sigma). Tissues were incubated overnight at 4° with gentle agitation with primary antibodies diluted in PBST and washed three times with PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... were first coated with poly-l-lysine (Sigma, 10 μg/mL 3 hours at 20°C) and then with Laminin (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat. #UFC500396) and centrifuged for 45 minutes at 4°C at 12,000g ...
-
bioRxiv - Immunology 2021Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were concentrated using a centrifugal filter unit (3 kDa MWCO, Merck Millipore; Cat. No. UFC900324) at 3500 rpm and 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Two sequential elutions were carried out with 100 μl 0.1 mg/ml 3× Flag peptide (Sigma) in RNC buffer at room temperature for 25 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains with AID degrons were treated with 250 µM auxin (3-indole acetic acid; Sigma-Alrich) in DMSO 30 minutes before harvesting ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were cooled on ice and then digested with 3 μg of sequencing grade trypsin (Sigma) and 3 μg of sequencing grade LysC (Wako ...
-
bioRxiv - Immunology 2022Quote: ... Sftpc-tdT mice were injected intraperitoneally with 3 doses of 100 mg/kg tamoxifen (Sigma-Aldrich) starting from 14 days prior to bleomycin administration ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 kDa (Merck Millipore cat # UFC500396) and centrifuged for 45 min at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... The fruits of AC were treated with 3 μM 24-epibrassinolide (EBL, Sigma, St. Louis, MO) or 5 μM Pcz as well as the combination of 3 μM eBL and 5 μM PCZ ...
-
bioRxiv - Neuroscience 2022Quote: ... and from day 8-11 was decreased to 3 µM and 0.2 mM AA,(Sigma-Aldrich), 0.2 mM dbcamp (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: Rats received a single intra-articular injection of either 3 mg/50 µL MIA (Sigma, UK) or 50 µL 0.9% saline (control group ...
-
bioRxiv - Molecular Biology 2023Quote: ... The treatment buffer included 0.5 mM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich, St. Louis, MO) to prevent cGMP degradation ...
-
bioRxiv - Neuroscience 2023Quote: ... for another 3 days of cultivation before fixing with 4 % paraformaldehyde (PFA, #P6148, Sigma-Aldrich, USA) for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: The cultured hippocampal neurons were fixed in a 3 % v/v glyoxal solution (Sigma-Aldrich, # 128465) containing 0.75 % acetic acid (Carl Roth ...
-
bioRxiv - Microbiology 2023Quote: ... and seven days post-infection 300ul of hNEC infection media (DMEM supplemented with .3% BSA (Sigma), 100 units/ml pen/strep (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... The lysate was transferred into a 0.5 mL filter unit (3-kDa molecular weight cutoff, Millipore) and concentrated to <100 μL by centrifugation at 14,000 g ...
-
bioRxiv - Microbiology 2024Quote: ... 20 µL of 500 mM of the protonophore (uncoupler) carbonyl cyanide 3-chlorophenylhydrazone (CCCP, Sigma-Aldrich) followed by 3 µL of 3 mM DIOC2 (3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was precipitated by adding 1/10 v/v 3 M sodium acetate (Sigma-Aldrich, S2889) pH 5.2 and 2 volumes 100% ethanol (Pharmco ...
-
bioRxiv - Neuroscience 2022Quote: ... and the brains were placed in 3 mL of formamide (Sigma-Aldrich®, St. Louis, MO) to allow EBA to diffuse from brain tissue and hold there for 72 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The secondary fluorescent antibody Alexa Fluor 488 (goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: The 3-(4,5-dimethylthiazol-2-ul)-2,5-diphenyl tetrasodium bromide (MTT, Sigma-Aldrich, St. Louis, MO) cytotoxicity assay measures mitochondrial reductases ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were diluted 1:3 with Urea-buffer (4.5 mM Urea (Sigma-Aldrich Cat#U1250), 10 mM Tris-HCl ...
-
bioRxiv - Physiology 2022Quote: ... Stained slides were washed and counterstained for 30-45 seconds with Gill’s 3 Hematoxylin (Sigma Aldrich), then rinsed thoroughly with water and mounted with glycerol gelatin (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... Selection was initiated after 2-3 days with 25-150μg/ml of Hygromycin B (Sigma-Aldrich) and maintained for 10-15 days ...