Labshake search
Citations for Millipore Sigma :
5201 - 5250 of 10000+ citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was washed once with TBST and incubated with primary antibodies at 4°C for 12 hrs (Phospho-ERK1/2 1:500 (Sigma Aldrich, #E7028); ERK1/2 1:1000 (Cell Signaling ...
-
bioRxiv - Cell Biology 2022Quote: Cultured cells were fixed with 4% paraformaldehyde (PFA) and 2% sucrose and then stained with Nile red (Sigma-Aldrich, St. Louis, MO) and HCS Cell Mask Blue (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... EGTA-eluates were pooled and concentrated to a final concentration of ∼2 mg/ml using an Amicon Ultra-4 cellulose centrifugal filter unit (Merck Millipore, Cat# UFC810024).
-
bioRxiv - Biochemistry 2022Quote: ... sodium hydroxide (1310-73-2) and α-amylase (DFP Treated, Type I-A, saline suspension, 647-015-00-4) were purchased from Sigma-Aldrich Company Ltd. ...
-
bioRxiv - Immunology 2024Quote: ... counted and 2-4×106 cells were washed twice in ice cold 0.9% saline made with NaCl (Sigma Aldrich, 31434-500G-M) and ultrapure HPLC grade water (Alfa Aesar ...
-
bioRxiv - Cancer Biology 2024Quote: ... were coated overnight with retronectin solution (32 µg/mL in PBS, WEHI) at 4℃ followed by blocking with 2% bovine serum albumin solution (Sigma-Aldrich, #A1595) in PBS at 37℃ for 30 min prior to coating with viral supernatant ...
-
bioRxiv - Genomics 2023Quote: ... 160 μl of 2x lysis buffer (2 % Triton x-100, 100 mM Tris-HCl pH 8.0, 300 mM NaCl, 0.2% sodium deoxycholate (Sigma-Aldrich, 302-95-4), 10 mM sodium butyrate (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... glycerol:relaxing solution (in mM: 100 KCl, 10 imidazole, 2 EGTA, 5 MgCl2, and 4 ATP) containing 1X protease inhibitor cocktail (Sigma-Aldrich P8340) and 1% triton X-100 ...
-
bioRxiv - Biophysics 2023Quote: ... with a voxel-size of 0.636 × 0.636 × 2 μm) are recorded once before and 4 h after actin-depolymerization using 10 μM cytochalasin D (Sigma-Aldrich, St. Louis) using brightfield and second-harmonic generation imaging microscopy ...
-
bioRxiv - Biochemistry 2022Quote: ... An amount of 2-4 mg of whole cell extract as incubated with 25 μL ANTI-FLAG® M2 affinity gel (Millipore Sigma) overnight at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... Samples were cryoprotected in a 30% sucrose solution (w/v) overnight at 4°C and frozen in 2-methylbutane (Sigma-Aldrich 106056) on dry ice ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were induced with 2-4% isoflurane and injected with 15 µL of CFA (Sigma-Aldrich F5881. Sigma, St. Louis, MO, USA) subcutaneously in the snout ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were induced with 2-4% isoflurane and injected with 15 µL of CFA (Sigma-Aldrich F5881. Sigma, St. Louis, MO, USA) subcutaneously in the snout ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells exposed to glutamine starvation were also treated with a freshly made 2 mM methionine sulfoximine (MSX, Sigma Aldrich 15985-39-4). The TCA precipitated samples were then centrifuged at 4000 rpm for 5 min at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chromatin from about 1.5×106 cells was incubated overnight at 4°C with 2–5 μg antibodies to FLAG epitope (M2; Sigma-Aldrich, #F1804, RRID:AB_262044), BRD4 (Cell Signaling Technology ...
-
bioRxiv - Bioengineering 2022Quote: ... Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (97%) and the 1H,1H,2H,2H-Perfluorodecanethiol (97%) were purchased from Sigma Aldrich Co ...
-
bioRxiv - Molecular Biology 2020Quote: ... The channels of the devices were rendered hydrophobic by silanization with 2% 1H,1H,2H,2H-perfluoro-octlytriethoxysilane (Sigma-Aldrich, USA) in FC-40 (Sigma Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... was added for 1h at RT followed by incubation with OPD (o-phenylenediamine dihydrochloride) revelation substrate for 10 min (Sigma-Aldrich, #P8287). Absorbances were analyzed at 492 vs 620 nm on an ELISA plate reader (Berthold).
-
bioRxiv - Neuroscience 2021Quote: ... or BSCO (Scopolamine N-butyl bromide, Sigma Aldrich) as pretreatment 1 hour before the start of the MRI measurement ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... or 400 mg/kg/day of ethyl carbamate (CAS # 51-79-6; Sigma, U2500, Lot # WXBC3505V) in deionized water via oral gavage for 3 consecutive days following the procedure outlined by Labash et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Neuroscience 2024Quote: ... The two odors used were 3-octanol (3-Oct) (Sigma-Aldrich 218405) and 4-methyl-cyclohexanol (MCH ...
-
bioRxiv - Neuroscience 2024Quote: ... a 3 mm-thick agar gel cap (Sigma, 3% in distilled water) was placed between the head and the surface coil ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were grown on glass coverslips and fixed in 4% paraformaldehyde (Sigma-Aldrich) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... were used to capture 4 µg anti-Flag Monoclonal M2 antibody (Sigma, F3165). Exo1-Flag (1µg ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed with 4% paraformaldehyde (ChemCruz) and permeabilized with 0.1% Triton X-100 (Sigma). Primary antibodies against β-tubulin (Cell Signaling) ...
-
bioRxiv - Developmental Biology 2021Quote: ... dechorionated and then fixed using 4 % (w/v) paraformaldehyde (PFA; Sigma-Aldrich, UK) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed two times with PBS and fixed using 4 % formaldehyde (Sigma) in PBS for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... already filled with 4 μL lysis buffer containing 0.05% Triton X-100 (Sigma) and ...
-
bioRxiv - Immunology 2021Quote: ... was performed upon 30 min of fixing the cells with 4% paraformaldehyde (Sigma) diluted in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: Nascent RNA was labelled by adding 500 μM 4-thiouridine (4sU)(Sigma, T4509) to cells harbouring HSA3 and Neo3 in T75 flasks and incubating at 37°C for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The residue was dissolved in ∼0.1-0.2 mL of 4% DMSO (Sigma-Aldrich) in acetonitrile (Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... The rats were then perfused with 500 mL of 4% paraformaldehyde (Sigma-Aldrich) in 0.1mM PBS(Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 15 min and blocked with 4% bovine serum albumin (BSA, Sigma-Aldrich) + 0.1% Tween-20 (Sigma-Aldrich ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... Virus was then concentrated using Amicon Ultra-4 centrifugal filter units (Merck-Millipore) and the solution was filtered with a 0.2 µm Acrodisc syringe filter (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2021Quote: ... The coverslips were mounted with Mowiol® 4-88 mounting media (Sigma #81381) and imaged on Olympus FV300 confocal laser scanning inverted microscope with 60X objective ...
-
bioRxiv - Neuroscience 2021Quote: ... The coverslips were mounted with Mowiol® 4-88 mounting media (#81381 Sigma) and imaged on Olympus FV3000 confocal laser scanning inverted microscope with 60X objective ...
-
bioRxiv - Neuroscience 2021Quote: ... the iPSC-derived mature neurons were fixed with 4 % paraformaldehyde (Sigma-Aldrich, P6148). The neurons were recognized using antibodies for neuronal markers (listed in Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were fixed by washing once in PBS and adding 4% paraformaldehyde (Sigma) for 20 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: 500mg of tissue was carefully diced into 40ml of 4°C RNALater (Sigma) for transport and storage ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg of RNAs were treated with DNase I (Amplification Grade, Sigma-Aldrich) following the manufacturer’s instructions ...