Labshake search
Citations for Millipore Sigma :
5151 - 5200 of 10000+ citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 200 μM Chloroquine (Sigma-Aldrich, C6628, CAS: 50-63-5), 10 μM Nigericin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... 5 % glycerol and 20 mM imidazole (Sigma-Aldrich cat I2399). Bound proteins were eluted in the binding buffer with increased concentration of imidazole in steps up to a maximum concentration of 500 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... wells were treated with 5 mg/mL MTT (Sigma, UK) for 4 hours at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... or JIB-04 (Sigma #SML0808 5 mM stock in DMSO), or doxycycline (Sigma #D3072 10 μg/ml stock in culture medium) ...
-
bioRxiv - Cell Biology 2024Quote: ... the proteasome was inhibited by adding 5 µM MG132 (Sigma) to the medium 1 h before MPS1 inhibition ...
-
bioRxiv - Neuroscience 2024Quote: ... We added biocytin (5 mg/mL, Sigma-Aldrich, Darmstadt, Germany) in the intracellular solution to fill cells during recording and subsequently visualized apical dendrite arbors using enzymatic 3,3’-Diaminobenzidine based staining (Vector Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 µM 5- Fluoro-2/-deoxyuridine (FDU; Sigma-Aldrich, 343333), 10 ng nerve growth factor (NGF ...
-
bioRxiv - Neuroscience 2024Quote: ... After blocking in 5% skim milk powder (Sigma Aldrich, 115363) for 1h at RT on a shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/mL insulin (I9278, Sigma, St. Louis, MO, USA), 8.4 ng/mL cholera toxin (030-20621 ...
-
bioRxiv - Biophysics 2024Quote: ... NFL was labeled with 5(6)-carboxyfluorescein NHS ester (Sigma), while NFH or NFM were labeled with Sulfo-Cyanine5 NHS ester (Lumiprobe) ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... tissues were blocked in 5% normal goat serum (Sigma-Aldrich) in PBS for 60 min in a humid chamber at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 mg/mL human insulin (cat#: I9278; Millipore Sigma), freshly supplemented with 100 ng/mL IL-34 (cat# ...
-
bioRxiv - Neuroscience 2024Quote: ... a mixture of 5% mercury chloride (Sigma-Aldrich, cat# M1136), 5% potassium dichromate (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... An antibody cocktail against 5-methylcytosine (EMD Millipore #MABE146, Sigma #SAB2702243 and Novus Biologicals #NBP2–42813 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Phospho-PAK4/5/6 (pSer474) (Sigma-Aldrich, SAB4503964).
-
bioRxiv - Neuroscience 2024Quote: ... rabbit Anti-Phospho-PAK4/5/6 (pSer474) (Sigma-Aldrich, SAB4503964); rabbit Anti-Phospho-14-3-3 (pSer58 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 833 μL of 5-10mM digitonin (Sigma-Aldrich, #D141-500MG) in a 1 mL syringe was injected from the unconnected catheter (IVC for periportal ...
-
bioRxiv - Microbiology 2024Quote: ... and mice were administered 5-fluorocytosine (1 mg/mL, Sigma) via drinking water to eliminate the CRISPR plasmid carrying the dhfr/yfcu selection cassette (negative selection) ...
-
bioRxiv - Molecular Biology 2024Quote: ... guts were blocked with 5% w/v BSA (A7906, Sigma) in PBST for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... or 4 mM EGTA (CAS 67-42-5, Sigma-Aldrich) were added to buffers as outlined in the text.
-
bioRxiv - Developmental Biology 2024Quote: ... were treated with 5 µM Alsterpaullone (ALP, Sigma-Aldrich A4847) or 0.015% DMSO for the indicated periods of time ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μL of 1mM stock of ionomycin (Sigma-Aldrich, I3909) and 10 μL of 1M stock of CaCl2 were added ...
-
bioRxiv - Genetics 2024Quote: ... 2μl of 20μM Adapter primer 2 (5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNN*N, SIGMA) and 39μl of water) ...
-
bioRxiv - Genetics 2024Quote: ... 1.6μl of 20μM Preamp primer (5’-[Btn]TGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNN*N, SIGMA) and 32.8μl of Nuclease free water) ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL 20 mM DBCOPEG4-biotin (DMSO solution, Sigma 760749), 20 mM K3BO3 (pH 7.0 ...
-
bioRxiv - Genomics 2024Quote: ... 6) 10 seconds in 5% Eosin Y solution (Sigma 318906), 7 ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were blocked in 5% Bovine Serum Albumin (BSA) (Sigma) in 1X PBS supplemented with 0.1% Tween 20 (0.1% PBS-T ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 or 10 mM methyl-β-cyclodextrin (mβCD) (Sigma-Aldrich) in DMEM for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.3μl of T3 (3,3’,5-Triiodo-L-thyronin, Sigma-T2877) or its vehicle was injected bilaterally in the dorsal CA1 (4ng/µl per side dissolved in 0.9% saline solution) ...
-
bioRxiv - Neuroscience 2024Quote: ... D(-)-2-Amino-5-Phosphonopentatonic acid (AP5, 50μM, Sigma-Aldrich), CGP-54626 (2μM ...
-
bioRxiv - Microbiology 2024Quote: ... then 5 ml ECL solution A (0.025% luminol (Sigma Aldrich) in 0.1 M Tris-HCL in H2O ...
-
bioRxiv - Neuroscience 2024Quote: ... we used a 5 µg/uL solution (Sigma, M1523-10MG) dissolved in fresh ACSF and injected 250 µL at 20 nL/min at a depth of 500 µm ...
-
bioRxiv - Plant Biology 2024Quote: ... Proteins were reduced by incubation with 5 mM dithiothreitol (Sigma) for 45 min at 60°C ...
-
bioRxiv - Microbiology 2022Quote: ... or manual extraction kits (Invitrogen PureLink genomic DNA kit or the Sigma GenElute kit). Normalised DNA (at a concentration of 0.2 ng/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chinese Academy of Science) were cultured on plates coated with 0.1% gelatin (Millipore) under feeder-free conditions with 5% CO2 at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were seeded in six-well plates and treated with cisplatin (Sigma Aldrich) or olaparib (Selleck Chemicals) ...
-
bioRxiv - Cell Biology 2019Quote: ... we transferred L3 to fresh RNAi plates containing 0.25 mM Paraquat (Sigma-Aldrich).
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... The plates were washed 3 times with 0.05% Tween-20 (P2287, Sigma-Aldrich) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The eluate was then spotted on a PEI-cellulose TLC plate (Sigma Z122882) and developed in a chamber equilibrated with 0.75 M KH2PO4 ...
-
bioRxiv - Immunology 2021Quote: ... and filtering through 0.65 µm low protein binding filter plates (Millipore, Burlington, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... lysates were collected on-plate with 1x RIPA buffer (EMD Millipore #20-188) with protease and phosphatase inhibitors (ThermoScientific #1861280) ...
-
bioRxiv - Neuroscience 2021Quote: ... spheroids were collected and transfered into ultra-low-attachment plates (#CLS3471; Sigma-Aldrich) with Essential 6 medium (#A1516401 ...
-
Multi cell line analysis of lysosomal proteomes reveals unique features and novel lysosomal proteinsbioRxiv - Molecular Biology 2020Quote: ... plates were coated with 100 μg/ml poly-L-lysine (Sigma Aldrich, P1524). For HEK293 and SH-SY5Y cells ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We sealed plates with BreatheEasy membranes (Millipore-Sigma, Diversified Biotech, Dedham, MA, USA) to prevent microbial contamination and cross-contamination ...
-
bioRxiv - Immunology 2021Quote: ... plates were coated with 2 µg/mL Galanthus Nivalis Lectin (L8275, Sigma-Aldrich) prior to blocking and capture of 2 µg/mL antigen ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... culture plates which had been previously coated with poly-D-lysine (SIGMA #P6407). Cells were incubated overnight in a humidified incubator in room air.
-
bioRxiv - Physiology 2020Quote: ... the plant essential oil was separated on analytical TLC plates (Sigma-Aldrich, Germany) and developed by petroleum ether ...
-
bioRxiv - Neuroscience 2019Quote: ... the arena was covered with a glass plate pre-treated with Sigmacote (Sigma). The fly was video recorded using a near infrared camera (IDS UI-3240CP-NIR ...
-
bioRxiv - Microbiology 2020Quote: ... a plate or microfluidic platform was coated with poly-L-ornithine (Sigma-Aldrich) (20 µg/mL ...