Labshake search
Citations for Millipore Sigma :
4951 - 5000 of 10000+ citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were rinsed 3 times in PBS and then mounted with Fluoshield (Sigma). Whole brain images were obtained on an Olympus virtual slide microscopy VS120-L100-W with a 10x objective (Olympus Canada Inc. ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-phospho Histone 3 (Ser 10) (Millipore; 1/500; Cat # 06-570), rabbit anti-myelin basic protein (Custom produced (Tingaud-Sequeira Angèle ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% SDS) supplemented with protease inhibitor and phosphatase inhibitors 2 and 3 (Sigma). Samples were subjected to dounce homogenization ...
-
bioRxiv - Physiology 2022Quote: Auxin plates were prepared by adding auxin indole-3-acetic acid (Sigma-Aldrich) from a 400 mM stock solution in ethanol into NGM at the final concentration of 1 mM (Zhang et al ...
-
Methacrylic acid-based biomaterials promote peripheral innervation in the subcutaneous space of micebioRxiv - Bioengineering 2022Quote: Some mice (N=3) were administered the IGF-1 inhibitor Tyrphostin AG1024 (Sigma) daily beginning on the day of hydrogel implantation for 21 days ...
-
bioRxiv - Neuroscience 2020Quote: ... prior to 3 final PBS washes and mounting in FluorSave reagent (Millipore Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... 40 µM (final concentration) of 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU, Sigma-Aldrich) and 1mM (final concentration ...
-
bioRxiv - Biophysics 2020Quote: ... 500 µL ethanol and 12 µL (3-Aminopropyl)triethoxysilane (APTES, 99%, Sigma-Aldrich) to a vial 38,39 ...
-
bioRxiv - Neuroscience 2021Quote: ... they were washed 3 times in PBS and mounted in Mowiol (Sigma-Aldrich). Images were collected using a confocal microscope (Olympus FV1200 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The eluent was placed in Amicon ultra centrifugal filters (3 kDa, Millipore, USA) with 200 μL H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μL 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide (MTT) solution (Sigma) was added to each well according to manufacturer’s instructions and analysed in a spectrophotometer at 580 nm ...
-
bioRxiv - Immunology 2020Quote: ... Cells treated with GW3965 (GW) (1 µM, Sigma-Aldrich, CAS: 405911-17-3) were compared either to vehicle (dimethylsulfoxide ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... The odorants used were 0.1% 3-octanol and 0.1% 4-methylcyclohexanol (Sigma Aldrich), controlled via three-way solenoids (Lee Company) ...
-
bioRxiv - Microbiology 2021Quote: ... and blocked during 1 h with 3 % BSA (Probumin) or 1% gelatin (Sigma) in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase, Sigma-Aldrich) from a mouse brain cDNA library using the forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... Calu-3 cells were pretreated with 1-100 µM kenpaullone (Sigma-Aldrich #422000) in growth media for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... samples were washed 3× in PBS and 150 nm gold nanoparticles (Sigma-Aldrich) were added for 15 min to act as fiducial markers for drift correction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... primary antibodies diluted in 3% (w/v) BSA (Bovine serum albumin, Sigma, A4503) in PBS-T was added on slides and incubated either for 2 hours at room temperature or at 4 °C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... by constant pressure and in the presence of 1 mM 3-AT (Sigma). The injected zygotes were cultured at 16C for Sp ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated using a 3 kDa cutoff spin concentrator (Millipore Sigma UFC9003) to a volume of 2 mL ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated in secondary antibodies (Supplemental Table 3) and DAPI (10g/ml, Sigma,) diluted in 10% NDS in 0.1% Triton-PBS for 90 minutes at r.t ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 8.0) and eluted with Strep buffer containing 3 mM Desthiobiotin (Sigma-Aldrich). Both 10-His tag and Twin-strep tag were subsequently cleaved by PreScission protease (P3C ...
-
bioRxiv - Neuroscience 2019Quote: ... 1:100 mouse anti-GFP (referred as anti-GRASP, Sigma #G6539, ref:3), 1:500 rat anti-N-Cadherin (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Cell Biology 2019Quote: ... Dynamin TKO was induced by the application of 3 µM Hydroxytamoxifen (OHT, Sigma) for 2 days ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were incubated with a rabbit anti-Gal-3 antibody (Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 ml of selective EZ containing 0.85 g/l Pluronic F-127 (Sigma) were inoculated with the overnight preculture in a 1:100 ratio and grown for 3-4 h at 37° C ...
-
bioRxiv - Plant Biology 2019Quote: ... the various lines were homogenized using 3 mm zirconium glass beads (Sigma-Aldrich), and genomic DNA (gDNA ...
-
bioRxiv - Genomics 2019Quote: ... The liver was digested by perfusion with Solution 3 (collagenase buffer, Sigma-Aldrich), flow rate 100-400mL/min ...
-
bioRxiv - Physiology 2019Quote: ... and 30µl of thrombin (3 units in 30µl of CaCl2 solution, Sigma-Aldrich). Gel polymerization occurs rapidly at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... DTT and 1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine were purchased from Sigma-Aldrich, St ...
-
bioRxiv - Synthetic Biology 2020Quote: ... followed by plating on SP4 agar containing 3 µg/mL of puromycin (Sigma). Colonies appeared after 3 to 4 days at 37 °C.
-
bioRxiv - Evolutionary Biology 2020Quote: ... cells were treated with 3% H2O2 (v/v in 1xPBS; Millipore Sigma, Canada) to eliminate endogenous peroxidase activity and dehydrated overnight in 70% ethanol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells were washed 3 times and maintained in XF-DMEM (Sigma-Aldrich) supplemented with 1 mM sodium pyruvate and 17.5 mM glucose ...
-
bioRxiv - Pathology 2020Quote: ... followed by a permeabilization step with 3% Triton™ X-100 (Sigma Aldrich) for an additional 5 min in the blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: The magnetic extraction set-up consisted of three 3 mL cuvettes (Sigma Aldrich) and a neodymium magnet (60×10×3 mm ...
-
bioRxiv - Biochemistry 2019Quote: ... coated for 3 hr at room temperature with monoclonal anti-FLAG (Sigma-Aldrich) and blocked for 2 hr at room temperature with 3% BSA and allowed to bind overnight at 4 °C with shaking ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.2 μL of MgCl2 (25 mM, Sigma-Aldrich, #M8266; CAS 7786-30-3), 2 μL of genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... 3 dpf MD zebrafish were soaked in 25 μg/mL lipoteichoic acid (Sigma) or 25 μg/mL peptidoglycan (Sigma).
-
bioRxiv - Physiology 2020Quote: ... blocked with PBST containing 3 % normal goat serum (blockPBST; Sigma-Aldrich, MO, USA) for 1 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Aggregates were incubated with primary antibodies in blocking buffer (3% BSA (Sigma, A9647) and 0.3% Triton X-100 in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Biophysics 2020Quote: ... the larvae were anesthetized with tricaine (3-amino benzoic acidethylester, Sigma Aldrich, MO) and immobilized in 1% low-melting-point agarose inside FEP (Fluorinated Ethylene Propylene ...
-
bioRxiv - Microbiology 2019Quote: ... 1/200 (v/v) each phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich), and 1/100 (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... The grids were washed 3 times with 1% bovine serum albumin (BSA; Sigma) in DPBS and blocked in 0.1% gelatin (Aurion ...
-
bioRxiv - Microbiology 2021Quote: ... we pumped ∼3-6 liters of fluid through 0.22 µm Sterivex filters (Millipore) on the seafloor ...
-
bioRxiv - Bioengineering 2021Quote: ... 48.42 mg of N-(3-Dimethylaminopropyl)-N’-ehtylcarbodiimide hydrochloride (EDC-HCl) (Sigma-Aldrich) were added to the solution along with 27.40 mg of N-hydroxy-sulfosuccinimide (sulfo-NHS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...