Labshake search
Citations for Millipore Sigma :
451 - 500 of 3692 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HTT (1:150, #MAB2166, Millipore) were used for immunoelectron labeling of isolated EVs ...
-
bioRxiv - Neuroscience 2023Quote: Anisomycin (150 mg/kg, i.p.; Sigma-Aldrich) was dissolved in equimolar HCl and sterile saline and had its pH adjusted to 7.5.
-
bioRxiv - Molecular Biology 2022Quote: ... mitomycin C (MMC, Sigma-Aldrich, 150 nM), Talazoparib (BMN 673 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 150-kDa FITC-dextran (Sigma, 69658) were used where indicated.
-
bioRxiv - Systems Biology 2022Quote: ... and 150 μM ascorbic acid (Sigma Aldrich). The cell seeding was done by preparing 5 × 106 cells/mL in 50% matrigel in maintenance medium and adding 200 μL of this preparation to obtain approximately 0.2 mm thick layer of cells in three dimensions within Matrigel ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 mM Tween-20 (Sigma, P9416-100mL)] for 120 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... Chloroform (SupraSolv, Sigma-Aldrich, #1.02432.1000; 150 µL) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-FLAG (1:150, Sigma, #3165), mouse anti-HA (1:300 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 150 U/ml DNase (Sigma-Aldrich), 5 mM MgCl2 (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: ... 150 nm gold beads (Sigma-Aldrich, USA) were observed in reflection mode to overlap the center of the excitation focus with the center of the depletion focus ...
-
bioRxiv - Microbiology 2023Quote: ... 150 μl of o-Phenylenediamine dihydrochloride (Sigma) was added for 30 min and then data was recorded at 450 nm.
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl (Sigma-Aldrich, 3624-05), 1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl (Sigma-Aldrich, 3624-05), 0.1% Tween 20 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-Sox9 (1:150, Millipore, AB5535), rabbit anti-Snai2 (1:500 ...
-
bioRxiv - Microbiology 2024Quote: ... α-amylase (150 units/mL, Sigma-Aldrich), proteinase K (1 mg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... and alcohol dehydrogenase (150 kDa) (Sigma-Aldrich). rFhENO (100 µg ...
-
bioRxiv - Molecular Biology 2024Quote: ... 150 μl of 60% acetonitrile (Sigma Aldrich) and 0.1% TFA (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 150 ng mL−1 Nocodazole (M1404, Sigma), 40 nM Hesperadin (S1529 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 150 μM sulfinpyrazone (Sigma Aldrich, S9509) for 15 min at 35°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and RT-qPCR was performed as described previously [48] using QuantiTect SYBR Green PCR kit and KiCqStart SYBR Green optimized primers from Sigma-Aldrich (KSPQ12012).
-
bioRxiv - Cell Biology 2021Quote: ... Primers were designed using the NCBI Primer designing tool and custom-synthesized by Sigma-Aldrich. The sequences of primers were listed in Supplementary Table ...
-
bioRxiv - Developmental Biology 2022Quote: ... with 200 nM of forward and reverse primers (Sigma-Aldrich; primers listed in table 2) on a QuantStudio 5 (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... The primers were predesigned and synthesized by Sigma-Aldrich (KiCqStart® SYBR® Green Primers). 20 ng cDNA was added to each well of a 96-well PCR plate with 1 μM forward and reverse primer for each nucleator ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µl protease inhibitor cocktail set (EDM Millipore 539134), and 10 µl murine RNase inhibitor (200U ...
-
bioRxiv - Neuroscience 2021Quote: ... and sterilized using stericup and steritop filtration set (Millipore). Dentate gyrus and SVZ were microdissected using SteREO Discovery V8 microscope (Zeiss ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with Protease Inhibitor Cocktail Set III (Merck Millipore), mixed by rotation at 4°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... complemented with protease inhibitor cocktail set III (Merck Millipore) and phosphatase inhibitor cocktail II (AG Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... and phosphatase inhibitors (Phosphatase Inhibitor Cocktail Set II, Millipore). Cells were lysed with glass beads in a cooled FastPrep (MP Biomedicals) ...
-
bioRxiv - Immunology 2020Quote: ... combined with on-Column DNase I Digestion Set (Sigma). Reverse transcription was performed using qScript cDNA Synthesis Kit (Quanta biosciences ...
-
bioRxiv - Developmental Biology 2022Quote: ... The complete probe set was ordered from Sigma Aldrich. Equal volumes of all 20 single probes were mixed and used as probe mixture containing 5 μM of each probe in detection stage 3.
-
bioRxiv - Molecular Biology 2023Quote: ... The on-column DNase I digestion set (Sigma, DNASE70) was used for genomic DNA (gDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The control group was set with 0.1% DMSO (Sigma), and the blank control was set with water ...
-
bioRxiv - Neuroscience 2023Quote: ... and Phosphatase Inhibitor Cocktail Set V (Merck Millipore, 524629). The samples were pipetted 10-20 times up and down until dissolved and were incubated on ice for 20 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 35μM dTTP (Deoxynucleotide Set, 100mM, Sigma, Cat# DNTP100-KT), and 15μM DIG-11-dUTP (Digoxigenin-11-dUTP ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 100 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, Roche complete protease inhibitor set, and Sigma phosphatase inhibitor set), incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... using the SYBR™ Green master mix (life technologies) and predesigned primers (KiCqStart® Primers, Sigma). Relative gene expression levels were normalized to β-actin in each sample with the ΔΔCT method.
-
bioRxiv - Cancer Biology 2020Quote: ... Mutagenic oligonucleotide primers were designed using Agilent QuickChange Primer Design program and purchased from Sigma-Aldrich with PAGE purification with the following sequences:
-
bioRxiv - Microbiology 2020Quote: HSA was depleted from CSF by placing 1mL of CSF into a 30 kDa Amicon™ Ultra Centrifugal Filter (Millipore, Temecula, CA, United States) and the solution was centrifuged at 20,000 × g for 10 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primers were synthesized by Sigma-Aldrich Sweden AB (Stockholm ...
-
bioRxiv - Cell Biology 2019Quote: ... All primers were purchased from Sigma.
-
bioRxiv - Cell Biology 2022Quote: ... and 400nM primers (Sigma, Poole, UK). Reactions were performed on a BioRad CFX RT-qPCR machine using the following parameters ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were obtained from Sigma-Aldrich Custom DNA Oligo service ...
-
bioRxiv - Immunology 2019Quote: ... using the following primer pairs (Sigma): bActin For 5’GTTCCGATGCCCTGAGGCTC3’ ...
-
bioRxiv - Developmental Biology 2019Quote: ... The sequences of sg-primers (SIGMA) used in this study are included in Supplementary Table 2.
-
bioRxiv - Developmental Biology 2019Quote: ... Selected primers were synthesized (Sigma-Aldrich) with the T7 promoter primer sequence (TAATACGACTCACTATAGGGAG ...
-
bioRxiv - Systems Biology 2019Quote: ... Primers were synthesised by Sigma-Aldrich, UK ...
-
bioRxiv - Cancer Biology 2019Quote: ... All primers were purchased from Sigma.
-
bioRxiv - Microbiology 2019Quote: ... Primers were obtained from Sigma Aldrich. Sanger sequencing was performed at the Massachusetts General Hospital DNA Core Facility ...
-
bioRxiv - Physiology 2019Quote: ... Commercially available primers (Sigma Aldrich, KSPQ12012) were used to determine levels of cyclooxygenase 2 (COX2) ...
-
bioRxiv - Plant Biology 2020Quote: ... and poly-T primers (Sigma-Aldrich).