Labshake search
Citations for Millipore Sigma :
451 - 500 of 9875 citations for SCF Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and the supernatant subjected to Ni-NTA affinity purification (HIS-Select Nickel Affinity Gel (Sigma Aldrich)) ...
-
bioRxiv - Biochemistry 2024Quote: ... and the protein solution was mixed with Co resin (His-select Cobalt Affinity Gel, Sigma Aldrich) for 1h at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cy3-mouse-anti-mouse aSMA (Sigma C6198), mouse anti-mouse αSMA (Sigma A2547) ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cells were seeded in 6-well plates (3.0 × 105 cells/well) coated with poly-L-lysine (Sigma-Aldrich, St. Louis, MO, USA) and incubated for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then, wildtype HEK293 cells (ATCC, CRL-1573) were infected in regular growth medium with 5 µg/mL polybrene (Sigma-Aldrich, TR-1003-G) and the lentivirus at a multiplicity of infection of 5 viral particles per cell ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids of Cypridina noctiluca luciferase and Omicron RBD or its mutants were co-transfected (9:1) into HEK293 cells using X-tremeGENE 9 (Millipore-Sigma XTG9-RO). After 16 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... Clarified lysate was loaded onto a gravity column containing 1 mL HIS-Select Nickel Affinity Gel (Sigma) pre-equilibrated with Resuspension Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 mM tris (2-carboxyethyl) phosphine (TCEP) and P8849 Protease Inhibitor Cocktail for His-tagged proteins (Sigma). The lysate was cleared at 25.000 × g for 30 min at 4°C and the supernatant was loaded on Protino®Ni-TED 2000 packed columns and purified as described by the manufacturer (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2021Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2×YT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... blotted onto nitrocellulose and the proteins were detected with an anti-His antibody (Sigma-Aldrich, Steinheim, Germany). To test whether 6His-PBBem1 and Cdc11 can bind simultaneously to Cdc24428-854 ...
-
bioRxiv - Biochemistry 2019Quote: ... Lysates were then added directly to 96-well His-Select Ni-NTA resin filter plates (Sigma Aldrich) and processed off-robot by centrifugation ...
-
bioRxiv - Biochemistry 2021Quote: Genes for His-tagged or Strep II-tagged nanobodies were cloned into the pET 26b vector (Novagen). The expression and purification of all His-tagged nanobodies have been described previously 12 ...
-
bioRxiv - Microbiology 2020Quote: ... and the supernatants were independently applied to a column of HIS-Select Nickel Affinity Gel (Sigma-Aldrich) equilibrated with 50 mM sodium phosphate buffer ...
-
bioRxiv - Biophysics 2021Quote: ... followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma). Further purification was performed by ion exchange chromatography (Source Q for WT and the S897E ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Biophysics 2020Quote: ... and passed through pre-equilibrated HIS-Select Ni-nitrilotriacetic acid resin (Ni-NTA) (Sigma-Aldrich Co., USA) at 4 °C for binding of 6x-His tagged protein ...
-
bioRxiv - Cell Biology 2022Quote: ... The following primary antibodies were used: anti-His (1: 2000, Cat No: 70796-4, Novagen, Madison, WI); anti-DNALI1 (1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The His-tag was removed by cleavage with 16 U of thrombin (Ref 27-0846-01, Sigma) added directly onto the beads for 2h at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... pneumoniae LicB with an N-terminal 10×His affinity tag in a modified pET-19b vector (Novagen) was overexpressed in E ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... plasmid coding for 6x-His-Cas9 were transformed in Rosetta DE3 Novagen competent cells (Merck Millipore, USA). Protein production was induced using autoinduction medium (Formedium ...
-
bioRxiv - Cell Biology 2020Quote: ... in the presence or the absence of 10 μg N-terminal-His-tagged ubiquitin (Sigma-Aldrich, #U5507), and ≈ 2 μg of purified recombinant mouse GST-Trim39 (WT ...
-
bioRxiv - Biophysics 2021Quote: ... The His-eluent was concentrated using a 30 kDa cutoff Amicon Ultra-4 centrifugal filter (Millipore UFC803008), filtered using a 0.22 μm Millex-GP PES membrane (Millipore SLGP033RS) ...
-
bioRxiv - Immunology 2022Quote: ... the 6x HIS tag region of the recombinant protein was removed following the vector manufacturers specifications (Novagen). This recombinant SmCI-1 was used to generate a rabbit anti-Sm-CI-1 polyclonal antibody using the Custom pAb service offered by Genscript.
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2xYT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Biochemistry 2023Quote: ... After several rounds of washing with His-AC washing buffer (supplemented with 0.1% Tween-20 (Sigma Aldrich), 0.1% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Genetics 2023Quote: ... imidazole was removed from the eluted His-SIRT5 using ultra-0.5 centrifugal filter units (UFC501096, Merck Millipore). 500 µl of the recombinant SIRT5 elution fractionation was added to the ultra-0.5 centrifugal filter units and centrifuged at 14,000 x g for 15 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-mouse agarose or mouse agarose (both Sigma) were added for 1 hour at 40C prior to 3 washes in Lysis Buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... Mouse anti-mouse NeuN (Millipore, MAB377, 1:100), and Rabbit Anti-MBP (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... and Mouse-anti-mouse/rat-NeuN (1;200, Millipore). Secondary antibodies include Goat-anti-Chicken-IgG-488 (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The obtained antisera were affinity-purified with recombinant Emi2-His protein electroblotted onto a membrane (Immobilon; EMD Millipore).
-
bioRxiv - Molecular Biology 2020Quote: ... Sph2-YM4271 cells were grown on synthetic dropout (SD)-His media supplemented with the inhibitor 3 mM 3-amino-1,2,4-triazole (3-AT; Sigma). All Y1H effector plasmids were separately transformed into the Sph2-YM4271 reporter strain and plated on SD/-Leu plates ...
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Plant Biology 2019Quote: ... at least four independent colonies were used for yeast two-hybrid assay on SD-Leu-Trp-His plates with and without 3-amino-1,2,4-triazole (Sigma). Colonies were imaged every 24 h post plating for 4-5 days.
-
bioRxiv - Cancer Biology 2020Quote: ... The pETDuet-1-His-BAP1-ULD+ASXL2-AB protein complex was expressed in Rosetta 2 (DE3) pLysS (Millipore). The bacteria bearing the desired plasmids were propagated with aeration at 37°C in 1L of 2YT to an A600 absorbance of approximately 0.6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were then incubated for 4 hours with anti-His hexahistidine antisera conjugated to horseradish peroxidase (HRP) (Sigma) diluted in TBST at a ratio of 1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... Dialysis was performed in concert with cleavage of the His-SUMO tag using the SUMO protease (Sigma Aldrich) at 20U/1mg of protein ...
-
bioRxiv - Molecular Biology 2022Quote: CobB driven deacetylation of His-PrsAc was analyzed by Western blot with anti-acetyl lysine antibodies (Sigma/Merck) and mass spectrometry ...
-
bioRxiv - Microbiology 2021Quote: ... Bound proteins were detected by western blot using anti-His antibody and streptavidin-HRP conjugate (SIGMA, reference GERPN1231).
-
bioRxiv - Zoology 2020Quote: ... recombinant RhATG5 and RhATG5191-199Δ were affinity-purified using Ni-NTA His•Bind Resin (Merck-Millipore, Darmstadt, Germany). Recombinant RhATG5 and RhATG5191-199Δ were then incubated with 10µg μ-calpain (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... 2020) genes fused with an N-terminal His-tag sequence have been inserted into a pET28a vector (Novagen) for protein expression in E ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were cleaved by incubation with 1.5 % (w/w) His-tagged HRV-3C protease (Millipore Sigma SAE0045) or 15 U/mg His-tagged SUMO protease (Millipore Sigma SAE0067 ...
-
bioRxiv - Biochemistry 2021Quote: A C-terminal 10x His-tagged Synechocystis PCC 6803 ocp gene (slr1963) was cloned in a pCDFDuet (Novagen), resulting in a plasmid named pEP4 ...
-
bioRxiv - Cell Biology 2020Quote: Fixed cells were permeabilized using ice-cold Hi-C lysis buffer (10 mM TRIS-HCl pH 8 [Sigma] ...