Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for Ethyl 5 3R 3 4 dihydroxybutyl thiophene 2 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Cell Biology 2022Quote: We synthesised biotinylated glutathione ethyl ester (bioGEE) by reacting sulfo-NHS-biotin (Thermo) with glutathione ethyl ester (Sigma) in 50mM NaHCO3 pH 8.5 for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: Every fish in this study was euthanized by supplying 1.5 g/L of ethyl 3-aminobenzoate methanesulfonate (MS-222, E10521, Sigma-Aldrich) to the fish tank water ...
-
bioRxiv - Molecular Biology 2021Quote: Adult male and female worms were relaxed and separated by incubation (15 min) in a 0.25% solution of the anaesthetic ethyl 3-aminobenzoate methanesulphonate (Sigma-Aldrich) dissolved in DMEM ...
-
bioRxiv - Neuroscience 2021Quote: Adult mosaic zebrafish (F0) were anesthetized in pH-buffered 0.2 mg/ml ethyl 3-aminobenzoate methanesulfonate solution (MS-222, Sigma-Aldrich). The caudal fin (2 mm of the end ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were removed from the egg and anaesthetised in a petri dish of seawater containing 10mg/mL ethyl 3-aminobenzoate methanesulfonate salt (MS-222, Sigma) prior to microinjection according to Gillis and Hall (2016) ...
-
bioRxiv - Developmental Biology 2022Quote: ... approximately 1 hour after the start of the light period the female now was removed from the tank and anesthetized briefly in another tank with egg water containing 0.02% buffered ethyl 3-aminobenzoate methane sulfonate (Tricaine, Sigma-Aldrich). Subsequently ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Immunology 2023Quote: ... Larvae were anaesthetized in zebrafish water supplemented with 200 μg/ml tricaine (Ethyl 3-aminobenzoate methanesulfonate, MS-222 Sigma #A5040) before any manipulation (infection or imaging ...
-
bioRxiv - Cell Biology 2023Quote: Adult zebrafish at the appropriate age were deeply anesthetized with 0.01% ethyl 3-aminobenzoate methane sulfonate (Tricaine, MS-222, Sigma Aldrich) and sacrificed by decapitation ...
-
bioRxiv - Immunology 2024Quote: ... followed by activation with 50 mM 3-Dimethylamino-propyl)-ethyl-carbodiimide Hydrochloride (EDC)/100 mM N-Hydroxysuccinimide (NHS) (Sigma-Aldrich) for 12 min at 10 ml/min ...
-
bioRxiv - Neuroscience 2024Quote: Adult mosaic zebrafish (F0) were anesthetized in pH-buffered ethyl 3-aminobenzoate methanesulfonate solution (0.2 mg/ml; MS-222, Sigma-Aldrich). A section of the caudal fin was removed using dissecting scissors (WPI Inc. ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 days post-fertilization (dpf) larvae were anesthetized in E3 medium containing 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and maintained at 28.5 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were then decorionated with 1mg/mL Pronase and anaesthetised immediately prior to microinjection using 0.2mg/ml Tricaine (Ethyl 3-aminobenzoate methanesulfonate) solution (Sigma-Aldrich). The injection solution (containing either cells as previously described ...
-
bioRxiv - Developmental Biology 2024Quote: ... worms were washed in RPMI and anaesthetised via a three-minute incubation in 0.25 % tricaine (ethyl 3-aminobenzoate methanesulfonate, #A5040, Sigma-Aldrich). From this point ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Genetics 2021Quote: ... Mono-ethyl fumarate (MEF, Sigma-Aldrich 128422) was added from a stock at 200 mM in DMSO to a final concentration of 10 or 20 mM ...
-
bioRxiv - Biophysics 2020Quote: ... Ethyl dimethylaminopropyl carbodiimide (EDC; Sigma; 0.04 M) and N-hydrosuccinimide (NHS ...
-
bioRxiv - Neuroscience 2021Quote: ... ethyl acetate (Sigma CAS #141-78-6), pentyl acetate (Sigma CAS #628-63-7) ...
-
bioRxiv - Pathology 2020Quote: ... then rinsed in ethyl cinnamate (ECi, Sigma) twice for 1 hour each time to undergo tissue clearing and refractive index matching.9 Finally ...
-
bioRxiv - Immunology 2021Quote: ... and extracted twice with ethyl acetate (Sigma). The organic phase was collected and dried using a speedvac (Thermo Scientific ...
-
bioRxiv - Genetics 2020Quote: ... Ethyl methanesulfonate (EMS; Sigma Aldrich Cat. M0880) was used to mutagenize ccpp-1(ok1821 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 70□μL ethyl acetate (Sigma-Aldrich) were added ...
-
bioRxiv - Genomics 2024Quote: Ethyl alcohol (Sigma-Aldrich, cat no. E7023)
-
bioRxiv - Physiology 2022Quote: ... tetramethyl rhodamine ethyl ester (TMRE; Sigma Aldrich) was added to the same well (final concentration ...
-
bioRxiv - Neuroscience 2023Quote: ... butyl acetate and ethyl lactate (Sigma-Aldrich product numbers 109584 ...
-
bioRxiv - Neuroscience 2023Quote: isoamyl acetate or ethyl butyrate (SIGMA-Aldrich). The odors were chosen based on literature showing that these two odors had no innate response in mice19 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ethyl Ester Perchlorate (TMRE; Sigma-Aldrich, 87917) and MitoSOX Red (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2020Quote: ... 6–8-week-old C57BL/6N mice were anesthetized by inhalation of isoflurane (3–4%) or intraperitoneal injection of 2% Avertin solution (2,2,2-tribromoethyl alcohol dissolved in Tert-amylalcohol (Sigma)) dissolved in saline ...
-
bioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Biophysics 2024Quote: ... 4% (3-Aminopropyl) triethoxysilane (APTES) (Sigma-Aldrich)-treated and 2% glutaraldehyde (Sigma-Aldrich)-activated 35mm glass-bottom dishes (Ibidi ...
-
bioRxiv - Microbiology 2020Quote: ... using Speed Bead Magnetic Carboxylate Modified Particles (Sigma-Aldrich, cat.no.45152105050250) (Hughes et al. ...