Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... 5 µM YM01 (StressMarq) for 24 hours or 1 µM geldanamycin (Sigma) for 24 hours ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 10 µL of DNase I (5 µg mL-1; Sigma-Aldrich, USA), and 10 µL of lysozyme (25 mg mL-1 stock ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM ATP and 5% glycerol) supplemented with 0.3× PhosStop (Sigma-Aldrich) and 1× cOmplete EDTA-free ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 1 hour in 5 μg/mL Hoechst 33342 (Sigma) at 37 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... cells were also treated with 1 μM 5-Aza-2’-deoxycytidine (Sigma) or 100 nM chaetocin (Cayman Chemical) ...
-
bioRxiv - Physiology 2021Quote: ... the cultures were treated with 5 µM IWR-1 (I0161, Sigma Aldrich) for 48 h ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.4) at 5% hematocrit with 1 mg/mL pronase E (Sigma) for 45-60 min at 37 oC ...
-
bioRxiv - Microbiology 2021Quote: ... HRP-conjugated secondary antibody (Sigma; 1: 20,000 in 5% skim milk, TBST), and washed with TBST ...
-
bioRxiv - Microbiology 2021Quote: ... with 7·5/1·875 mg/kg levodopa/carbidopa (D9628/C1335, Sigma), 0·15 mg/kg ropinirole (R2530 ...
-
bioRxiv - Immunology 2020Quote: ... Next 5 ml of L-15 containing 1 μg/ml DNase1 (Sigma) was added for 5 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... or α-Tubulin (clone B-5-1-2, Sigma-Aldrich, Cat#T5168). Primary antibodies were revealed with IRDye® 680 Goat anti-Mouse IgG or IRDye® 800CW Goat anti-Rabbit IgG (LI-COR ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg/ml insulin (I2643) and 1 µM Rosiglitazone (Sigma-Aldrich, R2408). After 3 days growth medium containing 1 µg/ml insulin cells were differentiated for 8 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Carmine red was prepared as 1% solution with 5% sucrose (Sigma-Aldrich) in 2% agar ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% glycerol) and supplemented with 1 mM phosphatase inhibitor cocktail3 (Sigma, P0044), 1 mM PMSF ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were stained with a 1:5 dilution of Giemsa solution (Sigma) in distilled water (dH2O ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... nicotinic acetylcholine receptor antagonist mecamylamine (5 mg kg−1,M9020, Sigma-Aldrich) and muscarinic acetylcholine receptor antagonist atropine (5 mg kg−1 ...
-
A new vulnerability to BET inhibition due to enhanced autophagy in BRCA2 deficient pancreatic cancerbioRxiv - Cancer Biology 2023Quote: ... 5 mM EDTA) with 1× protease inhibitor cocktails (Sigma-Aldrich, Sial-11836170001), and phosphatase inhibitor cocktails (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µl of 10 mM 5′ HEX labelled oligonucleotide primer (Sigma-Aldrich) and 2 µl ddH2O was incubated at 85°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... primary antibodies were anti-5-HT (1:1000, rabbit, Sigma, Lot #033M4805) and anti-Trhn (1:250 ...
-
bioRxiv - Physiology 2023Quote: ... Blots were blocked for 1 hour with 5% BSA (Sigma Aldrich; #820204) in TBST (1× TBS and 0.1% Tween-20 ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were counterstained with 5 μg mL-1 Hoechst 33342 (Sigma-Aldrich). Coverslips were mounted with Vectashield (Vector Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... membranes were blocked for 1 h in 5% skim-milk (Sigma Aldrich) at room temperature in PBS supplemented with 0.05% Tween-20 (PBST) ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was blocked for 1 hour in 5% skimmed milk (Sigma) in PBS-Tween 20 (0.1% ...
-
bioRxiv - Microbiology 2022Quote: ... 5% glycerol and 1 tablet of commercial protease inhibitor cocktail (Sigma Aldrich)).
-
bioRxiv - Genetics 2023Quote: ... Blots were blocked for 1 hour with 5% BSA (Sigma Aldrich; #820204) in TBST (1× TBS and 0.1% Tween-20 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or β-actin (1:10000 in 5% milk in TBST) (Sigma, A1978) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM 1,4-Dithiothreitol (DTT) and 5 mM N-Ethylmaleimide (Sigma-Aldrich)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
bioRxiv - Cell Biology 2023Quote: ... N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride (A3281, Sigma, MO, USA); 500nM ZSTK474 (S1072 ...
-
bioRxiv - Microbiology 2024Quote: ... A 5 nm colloidal gold-conjugated antibody (diluted 1:100, Sigma, USA) was applied to the grid ...
-
bioRxiv - Microbiology 2023Quote: ... challenge (parasite-to-macrophage ratio 5:1) with GSK2795039 (Sigma, 10 μM), AH6809 (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... 80 nm gold nanoparticles (Sigma-Aldrich, 1:5 dilution in blocking buffer) were added to the cells for 10 min as drift markers ...
-
bioRxiv - Cancer Biology 2024Quote: ... or FITC-Dextran (2000 kDa, FD2000s, Sigma Aldrich, 5 mg mL-1) was injected in the tail vein to visualize the brain vasculature ...
-
bioRxiv - Molecular Biology 2022Quote: A 558 bp region of the brm CDS (Flybase: FBpp0075278) encoding amino acids 1321-1506 was cloned into pET28a-6XHis (Sigma, St. Louis, MO). The construct was transformed into BL21-DE3 E ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:5000), mouse α-tubulin (B-5-1-2, 1:10000) and mouse α-Vinculin (hVIN-1, 1:5000) were obtained from Sigma-Aldrich. Rabbit α-Cyclin B1 has been described before [46] ...
-
bioRxiv - Bioengineering 2023Quote: ... along with 5% 2-hydroxy-1-[4(hydyroxyethoxy)phenyl]-2- methyl-1-propane (Irgacure 2959; Sigma-Aldrich) photoinitation ...
-
bioRxiv - Genetics 2022Quote: ... 5’-fluoroorotic acid (5’FOA; Sigma) was used at a concentration of 1 g/L in PMG containing 45 mg/L uracil ...
-
bioRxiv - Molecular Biology 2022Quote: Murine neuroblastoma Neuro-2a cells (#CCL-131; ATCC, Manassas, VA, USA) and maintained in DMEM (D5796; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% FBS (12676029 ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... was obtained from the Swansea University culture collection and grown on Sabourand dextrose agar (SDA, 40 gL−1 D-glucose, 10 gL−1 mycological peptone, 5 gL−1 technical agar (Sigma,UK), 0.5 gL−1 chloramphenicol ...
-
bioRxiv - Microbiology 2021Quote: ... Strains were seeded in lysogeny broth (LB, 10 g L-1 NaCl, 10 g L-1 tryptone, 5 g L-1 yeast extract, Sigma-Aldrich) at 30°C with shaking overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were ground in an ice-cold buffer (50 mmol.L-1 TRIS, 5 mmol.L-1 EDTA, 2 mmol.L-1 DTT, protease inhibitor cocktail (Sigma, St. Louis, MO, USA)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were washed in 1X PBS and co-cultured at a ratio of 5 parasites per macrophage (MOI 5:1) in RPMI 1640 medium without L-arginine (R1780, Sigma-Aldrich, USA) supplemented with 2% of inactivated FBS (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were then washed 3 times in 0.5% PBSTx for 5 minutes per time and incubated in Hoechst 33258 (use: 1 in 1000; stock: 20mg/ml; Sigma-Aldrich; B2883) for 30-60 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... We combined this immunohistochemistry with the one for serotonin (5-HT) using the rabbit IgG anti-5-HT (1/500, Sigma-Aldrich, 49545) and the goat anti-rabbit Fluor Alexa 568 (1/500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked in 5% BSA TBS-T or 5% skim milk TBS-T and incubated overnight at 4°C with the following primary antibodies diluted in 5 % BSA or 5% skim milk dissolved in TBS-T: pSer293-PDH (1:1,000) (Merck Millipore, Cat. no. ABS204), PDH (1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: C16 was formulated from powder as 2 mg/mL solution in a 20% 2-(hydroxypropyl)-β-cyclodextrin in ddH2O (HP-β-CD; Sigma, catalog #C0926) solution ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 hour long) we bleached the brains in a 5 : 1 mixture of methanol : 30 % H2O2 (Sigma) for 4 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... 250 mM sucrose and mixed in a 1:1 ratio with 5-nm colloidal gold solution (Sigma Aldrich) and vitrified as described above on glow-discharged Quantifoil R2/2 Au 200 mesh grids ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells in Accutase were added 1:2 to mTeSR™1 plus 5 μM Blebbistatin (Bleb, B0560, Sigma), pelleted at 150g for 5 minutes ...