Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 6 6 dimethyl 1 phenyl 6 7 dihydro 1H indazol 4 5H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Ms anti-αTubK40ac (clone 6-11B-1, Sigma T7451; 1:10,000), Rb anti-giantin (Biolegend #924302 ...
-
bioRxiv - Cell Biology 2021Quote: ... and acetylated tubulin (1:20,000; clone 6-11B-1, Sigma Aldrich). HRP-conjugated goat anti-mouse IgG and goat anti-rabbit IgG were used for secondary antibodies (1:10,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-acetylated-K40 6-11B-1 (1:500, Sigma-Aldrich), goat anti-HRP conjugated Alexa Fluor 647 (1:3000 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-acetylated tubulin (1:200, clone 6-11B-1, Sigma Aldrich), and anti-CENTRIN1 (1:100 ...
-
bioRxiv - Immunology 2022Quote: ... and 1 ug/mL FSL-1 (TLR2/6 agonist, Sigma-Aldrich), or 6 X 105 cfu/mL E ...
-
bioRxiv - Cell Biology 2023Quote: ... monoclonal mouse acetylated tubulin (clone 6-11B-1, Sigma; 1:1000), polyclonal rabbit alpha tubulin (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... anti acetylated α-tubulin (clone 6-11B-1, 1:500; Sigma); anti-Shot (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the AMPA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 μM, Sigma Aldrich), for 2 min at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... and 2 mM Trolox (6-hydroxy-2, 5, 7, 8-tetramethylchroman-2-carboxylic acid, 238813, Sigma) was flowed into chamber and then mounted onto microscope stage for smFRET observations ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were counter-stained with DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich) before mounting in Mowiol.
-
bioRxiv - Cell Biology 2020Quote: ... Some sections were additionally labeled with 4′,6-diamidino-2-phenylindole (DAPI, Sigma D9542 ...
-
bioRxiv - Genetics 2019Quote: ... Counterstaining was performed with either DAPI (4’, 6-diamidino-2-phenylindole dihydrochloride, Sigma) at 1μg/ml ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nuclear staining was performed with 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) diluted 1:4000 in PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... heavy L-lysine-[13C[4/6]15N[0/0]] HCL (Sigma-Aldrich, 643459) and heavy L-arginine-[13C6,15N[0/4]] HCL (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) and chloramphenicol was from Sigma-Aldrich. Haematoxylin and Eosin stain solution was from Thomas Baker.
-
bioRxiv - Neuroscience 2021Quote: Brain samples were embedded in 4-5% agarose (Sigma-Aldrich: 9012-36-6) in 0.1M PB and imaged using serial two-photon tomography (Han et al 2018 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2-amino-4-hydroxy-6-methylpyrimidine (33.0 mmol; 4.1 g, Sigma-Aldrich, USA) was dispersed in 1,6-diisocyanatohexane (148.6 mmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were stained with DAPI (4’,6-diamidino-2-phenylindole) solution (Sigma-Aldrich) and mounted with Fluoroshield (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4- to 6-week-old mice were given 2 mg tamoxifen (Sigma-Aldrich) dissolved in corn oil (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... Most samples were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... 6-8 min and 15 min post-activation with 4% paraformaldehyde (PFA, Sigma) diluted in microtubule stabilising buffer (MTSB ...
-
bioRxiv - Cell Biology 2020Quote: ... Slides were also incubated with 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for 5 min for nuclei staining and coverslipped using Fluoromount G (Southern Biotech ...
-
bioRxiv - Neuroscience 2021Quote: ... The nuclear stain 4□,6-diamidino-2-phenylindole (DAPI) was obtained from Sigma.
-
bioRxiv - Plant Biology 2021Quote: ... and 2.5 μg/ml of 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) (Kapuscinski and Skoczylas ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nuclear staining was done with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Sigma) at 1:1000 dilution of 1 mg/ml stock for 10 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclear staining was performed using 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Finally ...
-
bioRxiv - Genetics 2020Quote: ... Counterstaining was performed with either DAPI (4’, 6-diamidino-2-phenylindole dihydrochloride, Sigma) at 1µg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 6-8 min and 15 min post-activation with 4% paraformaldehyde (PFA, Sigma) diluted in microtubule stabilising buffer (MTSB ...
-
bioRxiv - Microbiology 2020Quote: ... Cell nuclei were stained with 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI; Sigma) diluted in PBS for 30 min at 20°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; D9542; Sigma-Aldrich) and the slides mounted with media (homemade ...
-
bioRxiv - Immunology 2021Quote: ... Dead cells were excluded using 4’,6-diamidino-2-phenylindol (DAPI, Sigma-Aldrich) or LIVE/DEAD Fixable Blue Dead Cell Stain Kit (Invitrogen Life Technologies) ...
-
bioRxiv - Bioengineering 2022Quote: ... nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI (Sigma-Aldrich, D9542), diluted to 0.1 μg/ml in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were labeled with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, D9542) for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore ...