Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 5 Iodo 1 Triisopropylsilanyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Neuroscience 2020Quote: ... cytosine-b-D-arabinofuranoside (Ara-C; 2 μM; Sigma) was added once to remove any proliferating cell from the culture ...
-
bioRxiv - Neuroscience 2021Quote: ... cytosine-b-D-arabinofuranoside (Ara-C, 2 μM, Sigma) was added to the medium at DIV 3 ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 mL 15% antifoam B emulsion (Sigma A5757) and 1 mL Tween 80 (Sigma P4780 ...
-
bioRxiv - Cell Biology 2023Quote: ... Latrunculin B (LatB, Sigma-Aldrich, final concentration 2 μM), Oryzaline (Duchefa Biochemie ...
-
bioRxiv - Developmental Biology 2024Quote: ... with 2 mg/mL Collagenase B (Sigma-Aldrich, #11088807001) at 37°C for 2 hours while shaking with trituration approximately every 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Neuroscience 2020Quote: ... and Fibronectin for >1h (Sigma, F1141 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μM 5-Fluoro-2’-deoxyuridine (FUdR, Sigma-Aldrich) for 3.5 hours at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... After addition of 10 μl methoxyamine (20 mg/ ml in pyridine; Sigma), vials were agitated for 90 min at 34 °C and 750 rpm ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mg of proteins were subsequently incubated for 1h with 10 μl of FAM134B or FAM134C antibodies (Sigma Prestige-HPA012077 and -HPA016492 ...
-
bioRxiv - Immunology 2023Quote: ... Staphylococcus-Enterotoxin-B (SEB) (5 µg/ml, Merck Sigma-Aldrich), DAPI (Merck Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cell lysates were transferred to a 96-well plate and reactions were initiated by adding 1 mM 5-thiobutyl butyrolactone (TBBL) and 1 mM 5′,5-dithiobis (2-nitrobenzoic acid) (DTNB) (Sigma Aldrich, D8130) in Pon2 activity assay buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... we injected 2 µl of 1% w/v FITC-conjugated cholera toxin B subunit (Sigma, C1655) in rats subjected to MCAO on day 14 post-stroke and analyzed the distribution of the labeling by confocal microscopy at 21 d post-stroke ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% horse serum and 1% P/S) supplemented with Gibco™ B-27™ Supplement (50X, 1:50, Sigma) for a further 10 days.
-
bioRxiv - Immunology 2024Quote: ... which after solidification were overlayed by basal medium containing Advanced DMEM/F12 + 1:100 Glutamax + 10 mM HEPES + 1.25 mM N-AcetylCystein + 1:50 B-27 Supplement + 1:100 N-2 Supplement + 50 ng/ml human EGF + 1:500 Primocin + 0.002% Heparin (Sigma), supplemented with additional factors as described in the main text ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... 3% 2-mercaptoethanol (Sigma Aldrich), and 0.25 mg/ml Proteinase K (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20-second bursts ...
-
bioRxiv - Cell Biology 2020Quote: ... Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma). The reaction was allowed to proceed for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated for 1h in either Tau12 (Millipore Sigma MAB2241; 1:1000), Tau46 (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... 1H-[1,2,4] oxadiazolo[4,3-a]quinoxalin-1-one (ODQ, Sigma-Aldrich, O3636) was dissolved in DMSO and 9,11-dideoxy-9α,11α-methanoepoxy prostaglandin F2α (U-46619 ...
-
Anisotropic Rod-Shaped Particles Influence Injectable Granular Hydrogel Properties and Cell InvasionbioRxiv - Bioengineering 2021Quote: ... The hard master was vapor-coated with Trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Sigma) in vacuum ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasma-activated and silanized with vapored trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma-Aldrich) overnight ...
-
bioRxiv - Bioengineering 2022Quote: ... molds were treated with vapor deposition of 1H,1H,2H,2H-perfluorooctyl-trichlorosilane (Sigma Aldrich) under vacuum for 10 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... PDMS moulds were then functionalised using Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma, 448931). A few drops of silane were placed on a glass petri dish and into a desiccator together with the PDMS moulds ...
-
bioRxiv - Microbiology 2023Quote: ... 5 × 10−5 M 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitors cocktails 2 and 3 (Sigma-Aldrich). Lysates were cleared by centrifugation at 17000 x g for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). 10 µL of lysate was transferred to a clear 96-well plate (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). 10 µL of lysate was transferred to a clear 96-well plate (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). Collected lysates were sonicated on ice with a probe sonifier (Branson ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). Collected lysates were sonicated on ice with a probe sonifier (Branson ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...