Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 250 µM auxin (indole-3-acetic acid; Sigma Aldrich) dissolved in DMSO was top-plated on agar to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... 150 µL of 3 M perchloric acid (Sigma, 244252) was added to each well and immediately covered with phenylethylamine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... by using 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma). These cross-linked peptides were used to immunize rabbits ...
-
bioRxiv - Biophysics 2022Quote: Powder form of 3-sn-phosphatidic acid (Sigma Aldrich), Brain phosphatidylserine (Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μM auxin (indole-3-acetic acid; Sigma-Aldrich) dissolved in DMSO was added to liquid media or top-plated on agar to induce degradation of the AID-tagged protein ...
-
bioRxiv - Genetics 2022Quote: ... Auxin (3-indoleacetic acid) (Sigma-Aldrich, St. Louis, MO) was made as a 1M stock in DMSO then added to 500μM or 750μM final concentration in liquid media or plates ...
-
bioRxiv - Plant Biology 2024Quote: 3-Indoleacetic acid (IAA) was purchased from Sigma-Aldrich. The stock solution was prepared using dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-(maleimido)propionic acid N-hydroxysuccinimide ester (Sigma). For co-grafted brushes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Microbiology 2022Quote: ... a 50:50 mixture of ALI x2 media (Airway Epithelial Cell Basal Medium with 2 supplement packs added (without triiodo-L-thyronine and retinoic acid supplements) and 1 ml BSA (3 µg/ml)) and DMEM supplemented with retinoic acid (15 ng/ml) (Sigma Aldrich, Gillingham, UK). Cells were fed apically and basolaterally until 100% confluent ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Biophysics 2020Quote: ... 2% MEM amino acids (50x, M5550, Sigma), 1% Penicillin Streptomycin (10,000 units/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Then 2 mM kynurenic acid (Sigma-Aldrich) was added into the compartment for the lumbar spinal cord ...
-
bioRxiv - Neuroscience 2020Quote: 2-phospho-Ascorbic Acid (Merck Sigma, #49752)
-
bioRxiv - Bioengineering 2021Quote: ... L-ascorbic acid-2-phosphate (Sigma-Aldrich), and 2mM L-Glutamine (Life Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 µM ascorbic acid 2-phosphate (Sigma), and 4.7 µg/mL linoleic acid (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 2% formic acid (FA; Sigma-Aldrich). MeOH was evaporated using N2 stream at room temperature and reconstituted in 150 µL reconstitution buffer (H2O/ACN/MeOH + 0,2% FA - 65:31,5:3,5) ...
-
bioRxiv - Biophysics 2021Quote: ... 2% Non-Essential Amino Acid (NEAA, Sigma) and 1% Glutamine ...
-
Development of follicular dendritic cells in lymph nodes depends on retinoic acid mediated signalingbioRxiv - Immunology 2020Quote: ... 86.5μM L-ascorbic acid 2-phosphate (Sigma) and 10ng/ml TGF-ß1 (Peprotech ...
-
bioRxiv - Bioengineering 2021Quote: ... 2-morpholinoethanesulfonic acid (MES, 19.52 g, Sigma) and NaCl (17.53 g ...
-
bioRxiv - Immunology 2021Quote: ... L-ascorbic acid 2-phosphate (Millipore-Sigma) was dissolved in water and sterilized with 0.22um syringe-filter and was added at a final concentration of 100 µg/mL (310.5 µM) ...
-
bioRxiv - Immunology 2021Quote: ... L-ascorbic acid 2-phosphate (Millipore-Sigma) was dissolved in water and sterilized with 0.22um syringe-filter and was added at a final concentration of 100 µg/mL (310.5 µM) ...
-
bioRxiv - Immunology 2023Quote: ... N’-bis(2-ethanesulfonic acid)] buffer (Sigma) for ten minutes at room temperature and blocked with cold normal donkey serum (Jackson ImmunoResearch ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 200μM L-Ascorbic acid 2-phosphate (Sigma) and 100 μg/ml penicillin-streptomycin with medium change every second day ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-aminohexadecanoic acid (Sigma-Aldrich #08051-1G) was protected as described by Koppitz et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-methyl-2-oxovaleric acid (KIC) (Sigma), and Sodium 3-methyl -2-oxobutyrate (KIV ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 µM Folic acid (#F8758, Sigma-Aldrich), 50 µM Thymidine (#T1895 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB) (Sigma) was dissolved in 10× PBS (pH 7.4 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 μl of formic acid (Sigma) was added to the remaining polar phase which was re-extracted with 500 μl of chloroform ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-morpholinoethanesulfonic acid (MES, 19.52 g, Sigma) and sodium chloride (NaCl,17.53 g ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-morpholinoethanesulfonic acid (MES, 19.52 g, Sigma) and NaCl (17.53 g ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5 mM Ascorbic acid 2-phosphate (Sigma), 200 mg/L CaCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were washed 2-3 times with warmed PBS followed by 50 μM 5-chloro-2’-deoxyuridine (CldU, Sigma #C6891) for 20 minutes or 50 μM CldU with 4mM hydroxyurea (HU ...
-
bioRxiv - Molecular Biology 2021Quote: Anti-α-tubulin (Sigma-Aldrich, clone B-5-1-2), anti-METTL18 (PROTEINTECH GROUP ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μM 5-Fluoro-2’-deoxyuridine (FUdR, Sigma-Aldrich) for 3.5 hours at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... Mouse anti-α-tubulin (B-5-1-2) (T5168; Sigma), Mouse anti polyglutamylated tubulin ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-alpha-tubulin B-5-1-2 (Sigma, T5168), mouse anti-alpha-tubulin TAT-1 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Tubulin (clone B-5-1-2) from Sigma Aldrich and anti-MUC5AC (clone 45M1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-tubulin MAb (clone B-5-1-2; Sigma) was used at a 1/4,000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... α-tubulin (T6074, clone B-5-1-2; Sigma-Aldrich), GFP (ab290 ...
-
bioRxiv - Microbiology 2024Quote: ... Uracil and 5-Fluoroorotic acid (0.05 mg/mL) (5-FOA, Sigma Aldrich). Consequently ...
-
bioRxiv - Biochemistry 2020Quote: ... nicotinic acid (cat. N4126), 2-aminopyridine-3-carboxylic acid (cat. A68300) and 1,1′-Carbonyldiimidazole (CDI, cat. 21860) were purchased from Sigma Aldrich. For the synthesis of NAI ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were replica-plated onto pABA− (2% glucose, w/v) plates with 0 µM or 25 µM linolenic acid (C18:3, Sigma). Colonies that grew on 25 µM linolenic acid were picked into YEPD overnight cultures and struck on YEPD plates ...