Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 2 3 Cyclohexenyl Ethyltrimethoxysilane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: Tissue culture dishes were coated with 3% poly-2-hydroxyethyl methacrylate (poly HEMA; P3932, Sigma-Aldrich) solution prepared in 95 % absolute ethanol and allowed to polymerize under sterile conditions at room temperature overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.5% (v/v) Triton X-100 supplemented) supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor cocktail (Roche) ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were washed 3 times with 200mL NM containing 2% L-cystein (Millipore, #52-90-4), pH 7.5 ...
-
bioRxiv - Developmental Biology 2024Quote: We mounted immunostained guts in 3% low-melting 2-hydroxylethyl agarose (Sigma-Aldrich 39346-81-1) and Prolong Gold or Prolong Diamond Antifade mounting media (Thermo Fisher P10144 ...
-
bioRxiv - Developmental Biology 2024Quote: ... For live confocal imaging of dat:eGFP and dat:mito-RFP dopaminergic neurons larvae were mounted in 1.2% low-melting point agarose in E3 embryo media containing 160ug/ml Ethyl 3-aminobenzoate methanesulfonate (Tricaine MS-222; Sigma-Aldrich 886-86-2) Tricaine anesthetic ...
-
bioRxiv - Pathology 2020Quote: Ela-Cre AT-1fl/+ and Ela-Cre AT-1fl/fl mice at 2-3 months of age were treated with tamoxifen (MP Biomedicals, 3mg/40g BW dissolved in 98% corn oil [Sigma] and 2% ethanol [Sigma]) by oral gavage once daily for three days to induce Cre recombinase activity ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Microbiology 2021Quote: ... sporozoites were added to 1 ml molten 3% agarose (2-Hydroxyethyl agarose – Sigma-Aldrich, dissolved in ddH2O), centrifuged and incubated at 4°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Molecular Biology 2020Quote: ... For cell treatments the following compounds were used: 2′,3′-Dideoxycytidine (1-10 μM, Sigma-Aldrich®), Ethidium bromide (50 ng/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Biochemistry 2020Quote: ... phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); Ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Developmental Biology 2020Quote: ... Phosphopeptide standards (0.1 pmol of MS PhosphoMix 1, 2, 3 Light; Sigma-Aldrich, St. Louis, Missouri, USA) was added to suspended sample in binding/equilibration buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... coli polar lipids (Avanti, US) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma Aldrich) in a 3:1 molar ratio ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1 mM IBMX (3,7-dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dione) (Sigma Aldrich)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... After that cells were treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-.Aldrich) in a 1:10 ratio in a culture medium and incubated at 37 °C for 3 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... phosphatase inhibitor cocktail 2 (P5726) and 3 (P0044) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and Doxorubicin (Adriamycin ...
-
bioRxiv - Cell Biology 2024Quote: ... DLD1 cells were treated for 2 h with 0.5 mM 3-indoleacetic acid (Sigma, stock in ethanol). At the time points indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... after 2-3 months of receiving HFD the mice were given 75 mg/kg STZ (Sigma-Aldrich) in 0.1M sodium citrate buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Cell Biology 2023Quote: Cell viability was determined by adding 0.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) substrate to cells and subsequent incubation at 37 °C and 5% CO2 for 1–2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Cancer Biology 2023Quote: 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... Patch pipettes (resistance 2-3 MΩ) were filled with an intracellular solution containing (mM): 110 CsMeSO3 (Sigma), 4.6 MgCl2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Figure 3 used 2 µL of 30 µm polystyrene beads (Polystyrene beads 30 µm, 84135, Millipore Sigma)mixed with NGM buffer solution to fully capture moving C ...
-
bioRxiv - Cancer Biology 2024Quote: Cell viability was assessed using colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay following by the manufacturer’s instructions (Sigma). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: Glass coverslips of 20×20 µm are coated with silane (2% (3-Trimethoxysil) propyl-methacrylate (Sigma #M6514)) ...
-
bioRxiv - Physiology 2024Quote: ... A 3:2 dilution of Oil Red O filtered solution (0.5 g/100 mL isopropanol; Sigma-Aldrich) was added to cells and incubated for 5 minutes at room temperature ...