Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The samples were incubated with 20 µM dichloro-dihydro-fluorescein diacetate (DCFH-DA) (Sigma-Aldrich) at 37 °C for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... as well as the specific antagonist dihydro-ß-erythroidine hydrobromide (DHßE, 8 µM, Sigma Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... The 7,8-dihydro-D-erythro-neopterin (DHNP) substrate for MtbFolB was purchased from Sigma-Aldrich. The 6-hydroxymethyl-7,8-dihydropterin hydrochloride (HP ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 μM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (678937, Sigma, UK) and 8 mM ascorbic acid (A15613 ...
-
bioRxiv - Cell Biology 2020Quote: ... 400 μM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (678937, Sigma, UK) and 8 mM ascorbic acid (A15613 ...
-
bioRxiv - Developmental Biology 2021Quote: ... CDM (IMDM + Ham’s F-12 at 1:1 (Sigma), chemically defined lipid concentrate (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:300 and 6-11 B1 (Sigma-Aldrich), an anti- acetylated α-tubulin antibody (1:2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... USA) and benznidazole (N-benzyl-2-nitro-1H-imidazole-1-acetamide) were from Sigma (St. Louis, USA).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Immunology 2023Quote: ... Staphylococcus-Enterotoxin-B (SEB) (5 µg/ml, Merck Sigma-Aldrich), DAPI (Merck Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-FLAG (F-3165, 1:5,000, Sigma), and anti-BAK1 (AS12 1858 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mM PMSF (Sigma #93482-50ML-F), 10 mM NaF ...
-
bioRxiv - Systems Biology 2024Quote: ... 1% pen/strep, 1% Glutamax, 50 μg/μL ascorbic acid [Sigma, St. Louis, MO, USA], 10 nM B-glycerophosphate [Sigma], 10 nM dexamethasome [Sigma]). After differentiation ...
-
bioRxiv - Microbiology 2021Quote: ... for 5h and then Protein G-DAF complexes were crosslinked using bis(sulfosuccinimidyl)suberate (BS3) (Sigma, S5799). Protein from total cell extracts (100 µg ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 100 µM of the nonspecific nitric oxide synthase inhibitor Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME [Sigma Aldrich], n=5), or 1.0 mM P188 and 100 µM L-NAME (n=5) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mg/ml of collagenase B (Sigma-Aldrich, 11088815001), and 40% FBS (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 10% B solvent A = 0.1% formic acid (FA, Sigma) in water (Thermo-Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... Lat B (stock, 10 mM; Sigma-Aldrich, MO, USA) and oryzalin (stock ...
-
bioRxiv - Neuroscience 2022Quote: Solutions of 10 mg/mL BrdU (Sigma B-5002) and 2.5 mg/mL EdU (Invitrogen A10044 ...
-
bioRxiv - Neuroscience 2021Quote: ... with 10% FBS (Sigma, Cat. No. TMS-013-B), supplemented with viral boost reagent (ALSTEM ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 mM b-glycerol phosphate (Sigma, St. Louis, MO), 10 nM dexamethasone (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 uM of b-AP15 (Sigma-Aldrich, Cat# 662140) or 100 uM IU-1 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... standard Western blot was performed using anti-SST and anti-α-Tubulin (1:8,000, B-5-1-2, mouse monoclonal, Sigma).
-
bioRxiv - Microbiology 2024Quote: ... α-tubulin was detected as a loading control with the mouse monoclonal antibody B-5-1-2 (Sigma, T5168, 1/4000) for 2 hrs at 25°C ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 5% Pluronic® F-127 (Sigma-Aldrich, St. Louis, MO) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... in BRB80 and then blocked by 5% Pluronic F-127 (Sigma-Aldrich) in BRB80 for 5 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... which was coated with 5% Pluronic acid F-127 (Sigma-Aldrich P2443) and rinsed with PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... pre-treated with 5% (w/v) Pluronic™ F-127 (Sigma, P2443) overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... in retinal samples were resolved by 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto and electro-blotted to nitro-cellulose membranes (Millipore, USA). The membranes were subsequently blocked with 5% nonfat milk for one hour and incubated overnight at 4 °C with primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mice were kept on 10 mg/L 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC; Sigma-Aldrich, Cat. No. PHR1731-1G) in drinking water when indicated ...
-
bioRxiv - Biophysics 2021Quote: ... Microcrystals 1-5 × 5-10 × 10-20 μm3 in size were passed through 100 micron plastic mesh filters (Millipore, USA) in the same mother liquor composition to eliminate the large single crystals and other impurities before the data collection ...
-
bioRxiv - Biophysics 2020Quote: ... Microcrystals 1-5 × 5-10 × 10-20 μm3 in size were passed through 100 micron plastic mesh filters (Millipore, USA) in the same mother liquor composition to eliminate the large single crystals and other impurities before the data collection ...
-
bioRxiv - Bioengineering 2021Quote: ... once with a 1% SDS-TRIS pH 11 solution (5% v/v of 20% sodium dodecyl sulfate #05030, from Sigma Aldrich and 2.4 % w/v TRIS base PBP151-500 from Fisher Scientific in reverse osmosis water ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...