Labshake search
Citations for GENEWIZ :
1 - 50 of 91 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Forty-five base pair double-stranded DNA (45bp dsDNA, tacagatctactagtgatctatgactgatctgtacatgatctaca) was synthesized by GENEWIZ (Shouzhou, China). LipofectamineTM 2000 were acquired from ThermoFisher Scientific (Shanghai ...
-
bioRxiv - Molecular Biology 2023Quote: ... The single clone was selected and verified by PCR (Gsmart Taq DNA PolymeraseDP1702S of Suzhou GENEWIZ biotech Co., LTD.), and the correct positive clone was obtained ...
-
bioRxiv - Biophysics 2021Quote: The codon-optimized full-length human ABCD1 gene and Caenorhabditis elegans PMP-4 were synthesized by GENEWIZ Company ...
-
bioRxiv - Genomics 2020Quote: ... The small RNA libraries were created using the Illumina TruSeq small RNA kit and sequenced on an Illumina HiSeq 2500 with a 1×50 single-end format (GENEWIZ).
-
bioRxiv - Genomics 2020Quote: ... Single-cell library preparation and sequencing was performed by GENEWIZ Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exome-sequencing was performed using SureSelect all human V6 capture kit and Illumina sequencing (GATC, Konstanz, Germany and GENEWIZ, Leipzig, Germany). Total RNA was isolated from frozen PDO pellets using the RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Dox 4 days (Day 4) thyroid (n=4; 2 males and 2 females for each group) were sequenced by GENEWIZ-NGS Europe (Germany ...
-
bioRxiv - Molecular Biology 2021Quote: The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: The open reading frame DNA sequences of human USP18(AA16-372) (Uniprot Q9UMW8) and human pro-ISG15(AA1-165)C78S (Uniprot P05161) were synthesized by GENEWIZ. C78S was substituted to stabilize ISG15 for purification (Narasimhan ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All pools and single individuals were sequenced in their own lanes of an Illumina machine by GENEWIZ LLC using 2×150 paired-end configuration.
-
bioRxiv - Neuroscience 2021Quote: ... The human SLC38A3 cDNA sequences were synthesized from GENEWIZ, China ...
-
bioRxiv - Microbiology 2021Quote: ... All DNA manipulations were checked by DNA sequencing (GENEWIZ, Takeley, England).
-
bioRxiv - Cell Biology 2020Quote: ... Point mutation as in references (37) of the ATP-binding pocket gatekeeper amino acid (M227G) were introduced by GENEWIZ (New Jersey, USA), with a modified Stratgene QuikChange® site-directed mutagenesis method.
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... coding sequences optimized for human cell expression were synthesized (GENEWIZ). Sequences encoding Myc-tagged GIP-2 ...
-
bioRxiv - Immunology 2019Quote: ... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
bioRxiv - Plant Biology 2021Quote: ... and the single mutants within the LVKIE region of the ancHMA—were synthetized by GENEWIZ (South Plainfield, NJ, USA) and subcloned into p41308-PikpN and p41308-PikpC plasmids for cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA sequencing was performed using Illumina HiSeq system in a 2 x 150-bp configuration (single index, per lane) by GENEWIZ. Starting from the raw .fastq files ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was performed on Illumina HiSeq platform (2 × 150 bp configuration, single index, 50 million reads per sample) by GENEWIZ.
-
bioRxiv - Plant Biology 2024Quote: ... and 30-50 ng of DNA were used to generate amplicons using a MetaVx™ Library Preparation kit (GENEWIZ, Inc., South Plainfield, NJ, USA).
-
bioRxiv - Cell Biology 2021Quote: ... an appropriate DNA fragment (made by GENEWIZ, based on the FlyBase sequence of Cnn-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then T4 ligase (GENEWIZ biotechT4 DNA LigaseCR1201S) was used to connect the target fragment to the carrier ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA for human METTL16 (UniProt: Q86W50) was prepared by gene synthesis (GENEWIZ GmbH, Germany) and subcloned into pFastBac1 recombination plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... All constructs were verified by DNA sequencing (GENEWIZ). The cloning for non-sfGFP tagged proteins expression were described in (Wang et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... a synthetic human ETS1 cDNA (NM_001143820) with custom flanking restriction enzyme sites (GENEWIZ, South Plainfield, NJ) was cloned into the pLOC vector (OHS5832 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Genomic DNA Clean & Concentrator®-10 (D4011) and sent for Sanger DNA sequencing (GENEWIZ UK Ltd).
-
bioRxiv - Microbiology 2020Quote: Shotgun sequencing of extracted DNA was performed by GENEWIZ Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA sequencing for all mutations were verified by GENEWIZ DNA sequencing (South Plainfield ...
-
bioRxiv - Biophysics 2019Quote: ... and confirmed by DNA sequencing (GENEWIZ, South Plainfield, NJ). The resulting amino acid sequences for all constructs are displayed in Figure 1 ...
-
bioRxiv - Bioengineering 2019Quote: ... The DNA oligonucleotides were synthesized and purchased from GENEWIZ. Full-length oligonucleotides were PCR-amplified using Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Immunology 2021Quote: A codon-optimized DNA fragment was synthesized by GENEWIZ encoding the S309-specific scFv and sub-cloned into the SFG retroviral vector retroviral backbone in-frame with the hinge component of human IgG1 ...
-
bioRxiv - Immunology 2020Quote: A codon-optimized DNA fragment was synthesized by GENEWIZ encoding the CR3022-specific scFv and sub-cloned into the SFG retroviral vector retroviral backbone in-frame with the hinge component of human IgG1 ...
-
bioRxiv - Microbiology 2023Quote: DNA library preparation and sequencing were performed by GENEWIZ, Inc ...
-
bioRxiv - Genetics 2023Quote: ... DNA library construction and sequencing were performed by GENEWIZ Company ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All constructs were validated by Sanger DNA sequencing (GENEWIZ).
-
bioRxiv - Biochemistry 2022Quote: 2645 polypeptides derived from above proteins were synthesized (GENEWIZ, Shanghai, China) to fabricate Microarray 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... this protein-coding region was synthesized by GENEWIZ (Plainfield, NJ, USA) based on the published genomic sequence of M ...
-
bioRxiv - Biophysics 2020Quote: ... and were confirmed by DNA sequencing (GENEWIZ, South Plainfield, NJ). The amino acid sequence numbering used corresponds to the numbering of the mature sequence as published with the X-ray structure (6) ...
-
bioRxiv - Molecular Biology 2022Quote: ... All constructs were confirmed by DNA sequencing (GENEWIZ, Suzhou, China). To optimizing the co-transfection assays ...
-
bioRxiv - Biophysics 2019Quote: ... and were confirmed by DNA sequencing (GENEWIZ, South Plainfield, NJ) [30].
-
bioRxiv - Genetics 2020Quote: ... the sequence was confirmed with DNA sequencing performed by GENEWIZ, Inc.
-
bioRxiv - Cancer Biology 2023Quote: ... we synthesized e1 and e4 DNA sequences (GENEWIZ, Cambridge, MA), either containing WT or deleted TF binding sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by DNA sequencing (GENEWIZ, South San Francisco, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Mutant flies were identified by sequencing the genomic DNA (GENEWIZ). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Plasmids with GPR1 mutations were confirmed by DNA sequencing (GENEWIZ).
-
bioRxiv - Microbiology 2019Quote: ... DNA sequences were confirmed by Sanger sequencing (GENEWIZ, South Plainfield, NJ).
-
bioRxiv - Immunology 2020Quote: ... Purified DNA was subjected to Sangers sequencing (GENEWIZ, South Plainfield, NJ). Lentivirus plasmids–encoding for BiTEs cDNA and 4th generation Lenti-X™ Packaging Single Shots (Takara Bio USA ...
-
bioRxiv - Biophysics 2023Quote: ... All constructs were verified by DNA sequencing (GENEWIZ, South Plainfield, NJ). Plasmids were transformed into chemically competent Escherichia coli Rosetta cells (Novagen ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding akuBGL without signal peptide was codon optimized (GENEWIZ, China) for overexpress in E ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA amplicons were sequenced using the Illumina HiSeq2500 instrument (GENEWIZ). Gene ranking was calculated by the MAGeCK RRA method77 and the volcano plot were generated by R version 4.1.2.
-
bioRxiv - Neuroscience 2021Quote: ... and obtained the human FLAG-APLP1(mut9) gene with a Flag tag in the N-terminal synthesized by GENEWIZ Bio ...