Labshake search
Citations for GENEWIZ :
51 - 56 of 56 citations for Human KIRREL shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The full sequences of all plasmids are listed in Supplementary Information (Excel Sheet Data) and their correctness is verified by Sanger sequencing (GENEWIZ) unless otherwise noted ...
-
bioRxiv - Genetics 2023Quote: ... candidate plasmids recovered from yeast surviving appropriate genetic selection were evaluated by both restriction digest and DNA sequence analyses (GENEWIZ / Azenta Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... pAWG-GFP-Nup98AG and pAWG-GFP-Nup98YG plasmids were generated by PCR amplification of Nup98AG and Nup98YG (obtained as geneblock from GENEWIZ) and cloning into AscI/PacI-digested pCopia-3XFLAG-StrepII-HA vector or pAWG-EGFP vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmid donor carrying the sequence to be inserted plus 500nt of homology upstream and downstream was synthetized by GENEWIZ. 106 SK-N-BE cells were transfected with 3μL of Lipofectamine 2000 (Life technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... the midP0188 encoding sequence was cloned into PiggyBac Dual promoter to generate midP0188-PiggyBac Dual promoter (GFP-Puro) Plasmid by GENEWIZ (Suzhou). According to the instructions of Neofect (Neofect Biotech Co. ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a gRNA that targeted the PlexA gene just after the transmembrane domain (CTTCGCTCACAGGCGATCTTACTTC) was injected into nos-Cas9 expressing flies together with a pUC57 plasmid containing a donor construct (synthesized by GENEWIZ/Azenta) flanked by gRNA1 target sites that would insert an HA tag and 3X STOP cassette ...