Labshake search
Citations for GENEWIZ :
1 - 50 of 62 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Amplification of the region of interest was done with the EpiMark® Hot Start Taq DNA Polymerase (New England Biolab, UK) and the resulting product was sequenced by Sanger sequencing (Beckman Coulters Genomics, GENEWIZ, UK.) DNA methylation analyses of bisulfite PCR amplicons were performed using Sequence scanner V1.0 ...
-
bioRxiv - Microbiology 2021Quote: ... All DNA manipulations were checked by DNA sequencing (GENEWIZ, Takeley, England).
-
bioRxiv - Biochemistry 2022Quote: ... TbPOLID variants wild type and polymerase-dead were cloned into pLew100-PTPPuro via Mfel and BamHI sites by GENEWIZ, Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... an appropriate DNA fragment (made by GENEWIZ, based on the FlyBase sequence of Cnn-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then T4 ligase (GENEWIZ biotechT4 DNA LigaseCR1201S) was used to connect the target fragment to the carrier ...
-
bioRxiv - Microbiology 2024Quote: All constructs in this study were cloned by polymerase chain reaction (PCR) and restriction digestion and inserts were verified by Sanger sequencing (GENEWIZ, Inc). All primers were purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... All constructs were verified by DNA sequencing (GENEWIZ). The cloning for non-sfGFP tagged proteins expression were described in (Wang et al. ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Genomic DNA Clean & Concentrator®-10 (D4011) and sent for Sanger DNA sequencing (GENEWIZ UK Ltd).
-
bioRxiv - Microbiology 2020Quote: Shotgun sequencing of extracted DNA was performed by GENEWIZ Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA sequencing for all mutations were verified by GENEWIZ DNA sequencing (South Plainfield ...
-
bioRxiv - Biophysics 2019Quote: ... and confirmed by DNA sequencing (GENEWIZ, South Plainfield, NJ). The resulting amino acid sequences for all constructs are displayed in Figure 1 ...
-
bioRxiv - Bioengineering 2019Quote: ... The DNA oligonucleotides were synthesized and purchased from GENEWIZ. Full-length oligonucleotides were PCR-amplified using Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Immunology 2021Quote: A codon-optimized DNA fragment was synthesized by GENEWIZ encoding the S309-specific scFv and sub-cloned into the SFG retroviral vector retroviral backbone in-frame with the hinge component of human IgG1 ...
-
bioRxiv - Immunology 2020Quote: A codon-optimized DNA fragment was synthesized by GENEWIZ encoding the CR3022-specific scFv and sub-cloned into the SFG retroviral vector retroviral backbone in-frame with the hinge component of human IgG1 ...
-
bioRxiv - Genetics 2023Quote: ... DNA library construction and sequencing were performed by GENEWIZ Company ...
-
bioRxiv - Microbiology 2023Quote: DNA library preparation and sequencing were performed by GENEWIZ, Inc ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All constructs were validated by Sanger DNA sequencing (GENEWIZ).
-
bioRxiv - Biophysics 2020Quote: ... and were confirmed by DNA sequencing (GENEWIZ, South Plainfield, NJ). The amino acid sequence numbering used corresponds to the numbering of the mature sequence as published with the X-ray structure (6) ...
-
bioRxiv - Molecular Biology 2022Quote: ... All constructs were confirmed by DNA sequencing (GENEWIZ, Suzhou, China). To optimizing the co-transfection assays ...
-
bioRxiv - Biophysics 2019Quote: ... and were confirmed by DNA sequencing (GENEWIZ, South Plainfield, NJ) [30].
-
bioRxiv - Genetics 2020Quote: ... the sequence was confirmed with DNA sequencing performed by GENEWIZ, Inc.
-
bioRxiv - Cancer Biology 2023Quote: ... we synthesized e1 and e4 DNA sequences (GENEWIZ, Cambridge, MA), either containing WT or deleted TF binding sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by DNA sequencing (GENEWIZ, South San Francisco, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Mutant flies were identified by sequencing the genomic DNA (GENEWIZ). Additionally ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Plasmids with GPR1 mutations were confirmed by DNA sequencing (GENEWIZ).
-
bioRxiv - Microbiology 2019Quote: ... DNA sequences were confirmed by Sanger sequencing (GENEWIZ, South Plainfield, NJ).
-
bioRxiv - Immunology 2020Quote: ... Purified DNA was subjected to Sangers sequencing (GENEWIZ, South Plainfield, NJ). Lentivirus plasmids–encoding for BiTEs cDNA and 4th generation Lenti-X™ Packaging Single Shots (Takara Bio USA ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding akuBGL without signal peptide was codon optimized (GENEWIZ, China) for overexpress in E ...
-
bioRxiv - Biophysics 2023Quote: ... All constructs were verified by DNA sequencing (GENEWIZ, South Plainfield, NJ). Plasmids were transformed into chemically competent Escherichia coli Rosetta cells (Novagen ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA amplicons were sequenced using the Illumina HiSeq2500 instrument (GENEWIZ). Gene ranking was calculated by the MAGeCK RRA method77 and the volcano plot were generated by R version 4.1.2.
-
bioRxiv - Biophysics 2019Quote: DNA sequences were verified by sequencing (GENEWIZ UK LTD, Bishop’s Stortford, UK).
-
bioRxiv - Microbiology 2023Quote: ... Purified genomic DNA was paired end sequenced (2 x 150 bp) (GENEWIZ). Sequence libraries were prepared with the NEBNext Ultra II FS DNA Library Prep 136 kit (New England Biolabs GmbH ...
-
bioRxiv - Cell Biology 2024Quote: ... All newly generated constructs were verified by DNA sequencing (GENEWIZ from Azenta).
-
bioRxiv - Genetics 2019Quote: The sGCSF full-length DNA samples with stop codons were synthesized by GENEWIZ and amplified with PCR using the following primers that were designed based on sGCSF sequences (GenBank ...
-
bioRxiv - Plant Biology 2022Quote: ... The template DNA for AVR-PikF was synthesized by GENEWIZ (Genewiz, Saitama, Japan). These expression vectors were used to transform Sasa2 (lacking AVR-PikD alleles and AVR-Pii ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR amplified DNA products were confirmed by sequencing (GENEWIZ®,https://www.genewiz.com).
-
bioRxiv - Developmental Biology 2023Quote: Illumina sequencing libraries were prepared from ChIP-enriched DNA by GENEWIZ (Suzhou, China). Libraries were constructed following the manufacturer’s protocol (NEBNext UltraTMII DNA Library Prep Kit for Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... an EGFP-FLAG-AviTag-encoding linear DNA segment was prepared by gene synthesis (GENEWIZ) and inserted into the pFastBac vector using In-Fusion kit (TaKaRa # 638910) ...
-
bioRxiv - Plant Biology 2020Quote: ... A Golden Gate compatible full-length genomic DNA version (Medtr5g036540.1) was synthesized (GENEWIZ, Germany) by removing the BpiI and BsaI restriction sites via silent mutations ...
-
bioRxiv - Immunology 2022Quote: ... The DNA sequences of all plasmids were verified by Sanger sequencing performed by GENEWIZ. Methods for LV production have been previously described (44) ...
-
bioRxiv - Microbiology 2022Quote: ... The purified DNA fragments were then submitted for Sanger sequencing (GENEWIZ, South Plainfield, NJ) using primers specific to the plasmid DNA next to either of the Tn5 mosaic ends (Tn5 SeqF ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Authenticity of the constructs were confirmed by Sanger DNA sequencing (GENEWIZ, Azenta Life Sciences).
-
bioRxiv - Developmental Biology 2024Quote: ... Homozygous and heterozygous katna1mutants were identified by PCR amplification followed by DNA sequencing (GENEWIZ). The primers used for genotyping were the following:
-
bioRxiv - Bioengineering 2020Quote: ... All of the constructed plasmids were verified by DNA sequencing (GENEWIZ, South Plainfield, NJ, USA).
-
bioRxiv - Neuroscience 2021Quote: ... and a portion of intron 15 (corresponding to mouse genomic DNA chr16:84,965,084-84,965,993 GRCm38/mm10) was synthesized by GENEWIZ and was housed within a vector that contained the neo cassette on the vector backbone ...
-
bioRxiv - Immunology 2021Quote: ... Forty-five base pair double-stranded DNA (45bp dsDNA, tacagatctactagtgatctatgactgatctgtacatgatctaca) was synthesized by GENEWIZ (Shouzhou, China). LipofectamineTM 2000 were acquired from ThermoFisher Scientific (Shanghai ...
-
bioRxiv - Bioengineering 2022Quote: ... The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta, South Plainfield, NJ), using the forward primer for amplification ...
-
bioRxiv - Cell Biology 2020Quote: ... Correct insertion of the sgRNA sequence in the cloning backbone was checked by Sanger DNA sequencing (GENEWIZ). C2C12 MS2-CAS cells were grown in medium composed by high-glucose DMEM (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Resulting DNA fragments were purified and sequenced using the amplicon-EZ service offered by GENEWIZ (Azenta Life Sciences).
-
bioRxiv - Plant Biology 2024Quote: From 50-100 ng of DNA were used to generate amplicons using a panel of primers designed by GENEWIZ (GENEWIZ ...