Labshake search
Citations for Addgene :
51 - 100 of 976 citations for ssc mir 369 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs coding for eIF4A1 and eIF4A1DQAD were PCR-amplified using primers TS64/TS65 and cloned into mTurquoise-C1 and mCitrine-C1 vectors (Addgene #54842 and #54587) using HindIII and BamHI restriction sites ...
-
bioRxiv - Cancer Biology 2019Quote: ... MiR-146a over-expression cassette was sub-cloned from pU61 into the pLKO.1 TRC vector (Addgene plasmid #10878). Packaging plasmids psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The amplifications of three PCR fragments containing four gRNA sequences (Fig. S5) with the respective primers and pCFD6 as a template (Addgene plasmid # 73915; from Simon Bullock), followed by Gibson assembly with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR 128a were inserted into the 3’UTR of pMIR luciferase reporter (Life Scientific). miR-10b reporters described previously (Ma et al. 2007) were obtained from AddGene. Reporters were co-transfected with Renilla luciferase (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... the miR-30a-shRNA cassette was then amplified and inserted into pDIO-DSE-mCherry-PSE-MCS (gift from Beatriz Rico (Addgene plasmid #129669 ...
-
bioRxiv - Microbiology 2019Quote: ... The insert was checked by Sanger single primer sequencing at Eurofins Deutschland (Germany) using published primers “M13/pUC Forward” (CCCAGTCACGACGTTGTAAAACG) and “L4440 Reverse” (AGCGAGTCAGTGAGCGAG) (Addgene plasmid # 1654 ...
-
bioRxiv - Systems Biology 2020Quote: ... was used to clone a pool of four sgRNAs per gene (AGPS, SLC2A11, ZC3H7A, PDCD2L, NPM1, EPS15, hsa-mir-761, RPAP1, SYAP1, TRAF3IP1, and EGFP) into lentiCRISPR v2 (Addgene #52961). iOvCa147 cells were transduced with viral particles encoding a Cas9 and sgRNA expression cassettes ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Genetics 2022Quote: ... test set variants and libraries were cloned into pAG416GPD-EGFP-ccdB (Addgene plasmid # 14316 ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Cell Biology 2022Quote: ... The internal ribosome entry site (IRES) was amplified with fwd primer 1998 and reverse primer 1903 from pMSCV-IRES-mCherry-FP (Addgene #52114). GFP-NLSx3 was amplified from our previously described GFP-NLSx3 pBabe puro vector [67] using fwd primer 1833 and rev primer 1834 ...
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Genetics 2023Quote: ... EPP2 and RN2 cells were retrovirally transduced with shRNAmir constructs cloned into pMSCV-miR-E-PGK-Neo-IRES-mCherry backbone (LENC; Addgene plasmid #111163), and initial infection levels were determined by flow cytometry based on mCherry expression 4 days post transduction (day 0).
-
bioRxiv - Microbiology 2023Quote: ... or with the packaging plasmid pCD/NL-BH*deltavpu/RT-that lacks RT activity due to the D110E mutation in the catalytic site (kindly provided by Jakob Reiser; Addgene #136985). CA stability mutants P38A and E45A were kindly provided by Stephen Goff ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers were used on the pCFD6 template (Addgene #73915) using high-fidelity Phusion polymerase (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... Primers were cloned into LentiGuide-Puro (Addgene plasmid #52963) by phosphorylating ...
-
bioRxiv - Immunology 2023Quote: ... and ligating primers into LentiGuide-Puro (Addgene, plasmid 52963). Colonies were validated by Sanger sequencing using pLK0.1/hU6 promoter primer (Eton Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... and annealed oligos for MLL3 SET were inserted into pLH-spsgRNA2 vector (Addgene #64114) (Ma et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... with primers introducing EagI restriction site from the plasmid (Addgene, #35572 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Annealed oligos for MLL4 SET or p300 HAT were inserted into lentiCRISPRv2 vector (Addgene #52961) (Sanjana et al ...
-
bioRxiv - Neuroscience 2023Quote: A set of PV-IRES-Cre animals injected with AAV2.9-CAG-Flex-ArchT-GFP (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the ultramers as primers and AAT-PB-CD2APtk (Addgene #86004) or AAT-PB-PG2APtk111 (Addgene #195124 ...
-
bioRxiv - Microbiology 2021Quote: ... After annealing each set of oligonucleotides they were ligated into the lentiCRISPRv2 shuttle vector (Addgene, #52961) that was linearized with BsmBI (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... the prime editor expression plasmid [SpCas9(H840A)-RT (Addgene no. 132775), FnCas9(H969A)-RT (developed in this study)] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Molecular Biology 2022Quote: ... as template and the following primers was cloned into pX458 (Addgene # 48138) at the AgeI FseI sites.
-
bioRxiv - Neuroscience 2021Quote: ... a gfp PCR product was PCR amplified from pPD95.75 (Addgene) using primers containing 35bp of overlap with the spop-1 gene immediately upstream of the predicted nuclear localization sequence ...
-
bioRxiv - Immunology 2022Quote: ... and HM13 (Table S2) were selected from a previously published set (26) and inserted into pspgRNA (Addgene plasmid # 47108 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The corresponding primers were cloned into the sgRNA expression cassette of pGREB31 (Addgene). The pTGE2 vector was constructed as described above based on target site sequence 12 (Figure 1B ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Cell Biology 2021Quote: ... gRNA primers were individually ligated into a variant of the pX335 vector (Addgene #42335) additionally containing the reporter protein GFP and a puromycin selection cassette (Cong et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 10xUAS promoter fragment amplified with primers 1010.C3 and 1010.C4 from Addgene plasmid 78897 ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... The synthesized oligo DNA primers for the guides were inserted into pX330 (Addgene #42230). For Tet-inducible expression of exogenous TopoII ...
-
bioRxiv - Molecular Biology 2022Quote: ... was amplified using primers casI.for and casv.rev2 and introduced into SwaI-opened pBig1b (Addgene) by Gibson assembly ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-1.5μl of Forward and Reverse primers and 50ng of lenti-sgRNA plasmid (Addgene; 52963) in a 50μl total volume reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers GFP-F-EcoRI and 3xNLS-R were used to obtain GFP-3xNLS from Addgene plasmid pEGFP-C1 EGFP-3xNLS ...
-
bioRxiv - Cancer Biology 2021Quote: ... MSCV EZH2 ΔSET-Hygro (cat# 49403) EZH2-Y641-F (cat# 80077) and pTRIPZ M)-YFP-EZH2 (cat# 82511) were procured from Addgene USA ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Cell Biology 2021Quote: Using the Neon transfection system pre-set program #16 (1400V, 20ms, 3 pulses) plasmids used for reprogramming (available from Addgene) were EN2L ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Microbiology 2019Quote: ... pCR-BluntII-TOPO (Addgene #41824) (29) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... and primers AJ20122 – AJ20116 and AJ20117 – AJ20121 with pORANGE empty (Addgene #131471, Willems et al., 2020) as template ...