Labshake search
Citations for Addgene :
251 - 300 of 1005 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 2xP4M-SidM was first amplified using P3 and P4 primers and GFP:P4M-SidM2x (a gift from Prof. Tamas Balla, Addgene plasmid # 51472) as a template and introduced into the vector pHD22 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Labor-associated endogenous gene promoters were cloned into the pGL4.23 backbone either directly from gDNA (using overhang-containing primers) in the case of the Fos promoter (Addgene catalog #188113), or from transitional pJET-1.2 vector backbones containing the cloned promoter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the sgRNA cassette was amplified by the primers with SpeI and XhoI overhangs using pgRNA plasmid as the template (Addgene 44251). To construct the pBBR1-MCS1-plac-cas9-sgRNA backbone ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dual guide backbone1-tRNA cassette was synthesised (Gblock, IDT) and amplified with primers containing the two guideRNA target sites followed by Gibson cloning into pX458 (Addgene #48138). Plasmids were transfected into the KOLF2_C1 hiPSC line with TransIT-LT1 (Mirus Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Genetics 2023Quote: ... by performing gibson assembly with the TRE3G promoter and P2A-BFP-WPRE amplified from TRE-KRAB-dCas9-IRES-BFP (addgene #85449) combined with nCas9(H840A)-MMLV(RT) amplified from pLenti-Synapsin-hChR2(H134R)-EYFP-WPRE (Addgene# 20945) and 7.3Kb (lentiviral backbone ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 cell line stably expressing Flag–Rab40b-4A was created by cloning Rab40b-4A (primers purchased from IDT, Coralville, IA) into lentiviral pCS2-FLAG vector obtained from Addgene (Cambridge, MA). Cell lines were routinely tested for mycoplasma ...
-
bioRxiv - Biophysics 2019Quote: ... an N-terminal LCTPSR FGE recognition motif on Cas1 was inserted by site-directed mutagenesis in plasmid pWUR871 with primers in Table S1 and co-expressed with FGE proteins (Addgene, plasmid #16132) (Carrico et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and amplified ZBP1 cDNA using forward: GGGAATTCATGGCCCAGGCTCCTGCT and reverse: TAGCGGCCGCCTAAATCCCACCTCCCCA primers from pEGFPN.1 vector cloned into LeGO-iG2-IRES-EGFP vector (Addgene plasmid #27341) between EcoRI and NotI sites followed by 5x strep-tag II (TGGAGCCATCCGCAGTTTGAAAAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
bioRxiv - Developmental Biology 2023Quote: Gene fragments were amplified from cDNA using oligonucleotide primers listed in Table S3 and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536) (Collins et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The individual ORFs were then amplified by PCR using primers ZJ6-ZJ10 (Table S2) and cloned individually into a pLEW100v5 vector (pLEW100v5 was a gift from George Cross; Addgene plasmid # 24011) using Gibson assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... with N-terminal HA tag added into primers followed by insertion into NotI/EcoRI-linearized pGCGFP-G418 (a gift from Andrew Pierce, Addgene plasmid #31264) using In-Fusion HD (Takara Bio) ...
-
bioRxiv - Cell Biology 2020Quote: ... We PCR amplified d2EGFP from M38 TOP-dGFP (Addgene #17114), engineering XhoI and NotI sites using primer sequences 5’-AAACTCGAG-GCCACCATGGTGAGCAAGG and 5’-AAAGCGGC-CGCCTACACATTGATCCTAGCAGAAG and cloned the coding region upstream of the β-globin-UTR ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR product was then subcloned into pcDNA3.1+ (Addgene) using BamHI and NotI restriction endonucleases (pcDNA3.1+-KanSacB).
-
bioRxiv - Developmental Biology 2021Quote: Kaede PCR product was amplified from the plasmid (Addgene #54726) for generating the template for capped mRNA synthesis (primers F ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR amplified and inserted into the plasmid pFGL1010 (Addgene, 119081 ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplified and cloned into lentiGuide-Puro vector (Addgene #52963). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding mRFPmars was PCR amplified from pmRFPmars (Addgene) with primers 4572/4573 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Microbiology 2021Quote: ... the gene encoding mRFPmars was PCR amplified from pmRFPmars (Addgene) with primers 4572/4573 ...
-
bioRxiv - Genomics 2021Quote: ... KRAB and dCas9 were PCR amplified from pCC_09 (Addgene 139094) (69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PUM2 was PCR amplified from pMAL-PUM2 (Addgene #120385). For PUM1 plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: CreERt2 was amplified by PCR using pCGA_creERt2 (Addgene plasmid #14797) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... jGCaMP7s was PCR amplified from pGP-CMV-jGCaMP7s (Addgene #104463). Following gel extraction ...
-
bioRxiv - Cell Biology 2022Quote: ... sgDNA was first PCR-amplified from pDD162 vector (Addgene 47549) using primers targeting the SWIP sequence ...
-
bioRxiv - Physiology 2022Quote: ... TBG promoter was PCR-cloned from the pAAV.TBG.PI.eGFP.WPRE.bGH (Addgene #105535) using primers with XbaI cloning site (5’-GGTTCTAGATGCATGTATAATTTCTACAG ...
-
bioRxiv - Microbiology 2022Quote: ... cpGFP was PCR-amplified from pTKEI-Tre-C04 34 (Addgene plasmid #79754 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first PCR amplified mGreenLantern from pcDNA3.1-mGreenLantern (Addgene #161912). Using MluI and XbaI ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was placed in pME (pDONR221 #398, Addgene) using a Gateway recombination reaction with BP clonase II ...
-
bioRxiv - Developmental Biology 2023Quote: ... an amplified PCR product from pCAG-TAG (Addgene, Plasmid #26771) was cloned into the KpnI-NotI sites of pcDNA3.1-H2B mCherry-poly(A83 ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP was amplified by PCR from pLeGO-iG2 (Addgene #27341). The IRES site was amplified by PCR from pInducer-21 (Addgene #46948) ...
-
bioRxiv - Cell Biology 2023Quote: ... NEMOD311N was obtained by PCR of pGEX- NEMOD311N (Addgene #11968). GFP was obtained by PCR of a GFP-containing plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... EBFP2 amplified by PCR from mTagBFP2-C1 plasmid (Addgene #54665), BbsI-silenced Sniper-Cas9 amplified by PCR ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR amplified constructs were inserted into mCherry-CRY2clust (Addgene #105624), using BsrGI/HpaI sites to obtain mCherry tagged JNK2α2 and SgrAI/HpaI sites to obtain mCherry tagged ASK1 constructs ...
-
bioRxiv - Systems Biology 2024Quote: ... was created by PCR cloning of IKK2-EE (Addgene, 11105) with BclI–MfeI ends and inserting into pBABE puro (Addgene ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... to enable downstream experiments with GFP based reporters together with this line) was amplified from pJFRC206 (with primers smGFP::v5_hifi_F/R from Addgene #63168, (Nern et al., 2015)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were PCR amplified from pcDNA4/TO-ORF24-3xFLAG (19) (Addgene #138423) with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-3xFLAG (C-terminal tag ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Immunology 2021Quote: ... Ovalbumin (OVA) amplicon was PCR amplified from pcDNA3-OVA (Addgene #64599) and cloned into pHIV-Luc-ZsGreen backbone (Addgene #39196) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Positive controls for PCR used lentiguide-Puro EGFP gRNA (Addgene 80036) which contained a gRNA sequence not present in the GeCKO library ...
-
bioRxiv - Cell Biology 2021Quote: ... Smo-GCaMP5G-mCherry was generated by PCR-amplification of GCaMP5G (Addgene plasmid 31788 ...
-
bioRxiv - Cell Biology 2021Quote: ... mKeima was amplified by pcr using mKeima-RED-N1 (Addgene #54597) as a template ...