Labshake search
Citations for Addgene :
151 - 200 of 2704 citations for pVectOZ GFP Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and pSNAPf-H2B control plasmid (Addgene #101124 ...
-
bioRxiv - Neuroscience 2023Quote: ... and an mCherry control vector (Addgene; pAAV5-CaMKIIa-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-CKIIa-mCherry (control, Addgene, injected titer of 2.3×10^13 parts/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... scrambled shRNA control (Addgene plasmid #1864), or an empty backbone pLKO.1 control (Addgene plasmid #8453 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequences of the control and ZEB1 shRNA were as follows: shRNA control (shCT) (Addgene sequence #1864):
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were injected with one of two control viruses: AAV9-hSyn-DIO-mCherry (AddGene Plasmid #50459), virus titer 2.17 x 1013 or AAV9-hSyn.HI.eGFP-Cre-WPRE-SV40 ...
-
bioRxiv - Genetics 2021Quote: GFP-expressing pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138). Three crRNAs targeting human TMEM67 (RefSeq NM_153704.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... or into ‘All-in-one-GFP’ plasmid (AIO-GFP, gift from Steve Jackson (Addgene plasmid # 74119 http://n2t.net/addgene:74119 ...
-
bioRxiv - Biophysics 2019Quote: ... pCAG:GPI-GFP (GPI-GFP) was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 32601). Mfn2-YFP was a gift from Richard Youle (Addgene plasmid # 28010) ...
-
Antigen-dependent inducible T cell reporter system for PET imaging of breast cancer and glioblastomabioRxiv - Synthetic Biology 2022Quote: ... The HSV-tkSR39-GFP construct was cloned from cEF.tk-GFP (Plasmid #33308, Addgene, MA), which was deposited by Pomper et al.17 using site-directed mutagenesis as described in the Supplemental Fig ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-ER GFP encoding GFP tagged SEC61β was a gift from Pantelis Tsoulfas (Addgene plasmid #80069 ...
-
bioRxiv - Neuroscience 2021Quote: ... The H2B-GFP fragment was amplified from the CMV-H2B-GFP (Addgene plasmid #11680) plasmid using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-Jaws+GFP-FLEX (pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2], Addgene) for optogenetics inhibition of STN somas projecting to MLR ...
-
bioRxiv - Molecular Biology 2022Quote: ... pAAV-Camk2a-iCre was generated by replacing GFP in pAAV-CAMKII-GFP (Addgene, 64545) with iCre (a codon-optimized Cre recombinase) ...
-
bioRxiv - Microbiology 2022Quote: ... pMRX-IRE-Blast-GFP-LC3 (subcloned from pBABE-Puro-GFP-LC3 vector, Addgene # 22405), pMRX-IRE-Puro-mStrawberry-Galectin3 (kindly provided by Prof ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and GFP with a minimal promoter amplified from pMPRAv3:minP-GFP (Addgene plasmid #109036) using primers MPRA_v3_GFP_Fusion_F and MPRA_v3_GFP_Fusion_R was inserted by Gibson assembly resulting in the 200 bp oligo sequence positioned directly upstream of the promoter and the 20 bp barcode falling in the 3’ UTR of GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... the GFP fluorescent tags of ITGB3-GFP (gift from Jonathan Jones – Addgene plasmid #26653) and GFP-Talin1 (gift from Anna Huttenlocher – Addgene plasmid #26724 ...
-
bioRxiv - Microbiology 2023Quote: ... we used the phage UbiC G3BP1-GFP-GFP plasmid originally from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Biochemistry 2020Quote: ... GFP-NPM WT (Addgene; 17578) were from Xin Wang ...
-
bioRxiv - Cell Biology 2020Quote: ... LifeAct-GFP was from Addgene.
-
bioRxiv - Cell Biology 2022Quote: ... Stargazin-GFP-LOVpep (Addgene #80406), LBR pEGFP-N1 (Addgene #61996) ...
-
bioRxiv - Cell Biology 2021Quote: ... Rtn4a-GFP (Addgene plasmid #61807) and mCherry-Climp63(mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... pTalin head-GFP (32856 Addgene), and pEGFP-C1 (Clontech).
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-hSyn-Cre-GFP (Addgene plasmid #68544 ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-2xSidM (Addgene plasmid #51472) was a gift from Tamas Balla ...
-
bioRxiv - Cancer Biology 2021Quote: ... GFP-rab11 WT (Addgene #12674), His-Ubiquitin (Tauriello et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expressing vector (Addgene 16664). Progerin construct (Addgene 17663 ...
-
bioRxiv - Immunology 2022Quote: ... and ASC-GFP (Addgene 73957) were established under G418 (1mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-PGK-GFP (Addgene; 19070) was included as a control ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV-GFP (AAV1.hSyn.EGFP.WPRE.bGH, Addgene); AAV-RFP (AAV1.CAG.tdTomato.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2020Quote: ... CBFRE-GFP (Addgene plasmid #17705) was deposited by Nicholas Gaiano (Mizutani et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... TOP-GFP (Addgene plasmid #35489) was deposited by Ramesh Shivdasani (Horst et al. ...
-
Ventral tegmental area glutamate neurons mediate the nonassociative consequences of traumatic stressbioRxiv - Neuroscience 2021Quote: ... AAV5-hSyn-DIO-GFP (Addgene), or AAV1-Syn-FLEX-GCaMP6m (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... and pGEX6P1-GFP-Nanobody (Addgene #61838 ...
-
bioRxiv - Neuroscience 2022Quote: ... The KIF13B-GFP plasmid (RRID:Addgene_134626) was a gift from Marvin Bentley 25 ...
-
bioRxiv - Genetics 2020Quote: ... or GFP (Addgene 105535-AAV8) under the control of the hepatocyte-specific thyroid-binding globulin (Tbg ...
-
bioRxiv - Neuroscience 2020Quote: ... with pRK paxillin-GFP (Addgene, #50529 ...
-
bioRxiv - Cancer Biology 2019Quote: ... sgTrack-GFP (Addgene plasmid # 114012) and sgTrack-mCherry (Addgene plasmid # 114013) ...
-
bioRxiv - Biochemistry 2020Quote: ... mH2A1.2-CT-GFP (Addgene, 45169) were from Brian Chadwick ...
-
bioRxiv - Biochemistry 2021Quote: pET22b: GFP (Addgene, Plasmid #11938)
-
bioRxiv - Neuroscience 2021Quote: ... GFP-NR2B (Addgene Plasmid # 45447), myc-FRNK (Addgene Plasmid # 74481) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Vsp1-R152Q-GFP (Addgene, 51884), Vsp1-GFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-Rab5AS34N (plasmid #35141; Addgene), CFP-Rab5A (Heo et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The GFP::L4440 plasmid (Addgene), containing a full-length (857 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... Su9-GFP (Addgene, #23214 [33]), for expression of Su9-(SaCas9/LbCas12a/AsCas12a/PI)-GFP and Su9-(mutant/dLbCas12a)-GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and ITGB6-GFP (Addgene, #13293) mammalian expression constructs were used for respective gene overexpression in cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... pGEX6P1 GFP Nanobody (#61838, Addgene) was purchased from Addgene and subcloned to pGEX6P1 for improved induction ...
-
bioRxiv - Neuroscience 2022Quote: pAAV-CaMKII-GFP (Addgene:64545) were purchased from Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-Rab5A(Q79L) (35140, Addgene); mCherry-Rab5A(Q79L ...