Labshake search
Citations for Addgene :
1 - 50 of 51 citations for nm23 H1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and SGL40C-H1.EFS.RFP657 (Addgene #69148) vectors were used to generate lentivirus vectors for sgRNA delivery ...
-
bioRxiv - Bioengineering 2021Quote: ... and H1 promoter sequences (Addgene#61089) were either synthesized or PCR-amplified and then cloned into the px552-U6-CAG-mCherry plasmid using an NEBuilder HiFi DNA assembly kit (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... and SGL40C-H1.EFS.RFP657 (Addgene #69148) vectors were used for sgRNA delivery via lentivirus ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transfected with WT RNase H1 (Addgene, 111906), the D210N mutant (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... For SF8628 and DIPG1 cells the H1 library (Addgene #1000000132) (Xu et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into pSIH1-H1-puro vector (#26597; Addgene). cDNA sequences of PAK1 mutants with a C-terminus Flag tag were synthesized at BGI Genomics (Beijing ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pEGFP-RNAse H1 was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108699 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The following sgRNAs were expressed using a pCDNA-H1-sgRNA vector (Addgene #87187):
-
bioRxiv - Cell Biology 2022Quote: ... Two guide RNA (gRNA) sequences were cloned using a pScaffold-H1 (118152, Addgene) on a lentiCRISPR v2 backbone (52961 ...
-
bioRxiv - Neuroscience 2024Quote: ... and lentivirus (LV)-H1-EGFP was packaged together with psPAX2 (Cat. No. 12260, Addgene) and pMD2.G (Cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... tIMEC-A-H1 cell line was generated by stable nucleofection of ppyCAG_RNaseH1_WT plasmid (Addgene, 111906)16 using the P1 Primary Cell 4D-Nucleofector X kit (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: hES cells (H1) were thawed at P29 and transfected with 3.3µM of each hCas9D10A (Addgene #74495), and a gRNA/donor plasmid (pUC_lmnA_Neo_exn1_donor_fixed containing gRNA sequence GCAGGAGCTCAATGATCGCTTGG ...
-
bioRxiv - Cell Biology 2022Quote: ... H1 hESCs were then co-transfected with sgAAVS1-pX458 and a GCaMP6f donor vector (Addgene #73503) containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: Hela-H1 cells were transfected with a plasmid encoding the VSV-G gene (pMD2.G; Addgene #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’UTR sequence of histone H1 sequentially into the backbone vector pFGL822 (Addgene #58225, Basta resistance); pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pEGFP-RNAse H1 was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108699; http://n2t.net/addgene:108699; RRID: Addgene_108699). HEK293 were transfected using PEI-25K (polysciences Inc. ...
-
bioRxiv - Genomics 2023Quote: ... according to the manufacturer’s instructions to remove the 78 bp mitochondrial localization signal (MLS) from RNase H1 cDNA (AddGene; pFRT-TODestGFP_RNAseH1 ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviruses were generated by inserting RIIα-IRES2-GFP expression cassettes into a pFUGW-H1 lentiviral vector (Addgene cat no. 25870) containing a shRNA sequence targeting for rat RIIα ...
-
bioRxiv - Cell Biology 2020Quote: ... The coding sequence of turquoise was amplified from pLL3.7m-mTurquoise2-SLBP (18-126)-IRES-H1-mMaroon1 (Addgene vector no. 83842) using the following primer pair ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... separated by a P2A self-cleaving peptide (Addgene ID NK676).
-
bioRxiv - Molecular Biology 2024Quote: ... # 48076) and a transit peptide (in plasmid pICH78133; Addgene # 50292) to target the biosensor to the nuclei and chloroplast stroma respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... RPA3 open reading frames (ORF) were cloned from cDNA of H1 ESCs and GFP ORF was cloned from pInducer21 (Addgene, Cat # #46948). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Plant Biology 2020Quote: ... the Hip1 sequence was amplified without signal peptide and cloned into the pET28a (+) expression vector (Addgene, USA), eventually having a His-tag at the N-terminus ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sequences described above were cloned in frame with the signal peptide NLS (in plasmid pICH86988; Addgene (www.addgene.org) # 48076 ...
-
bioRxiv - Biochemistry 2020Quote: ... and substrate domain (i.e., WMEDYDYVHLQG, a peptide derived from p130cas)—from its parent plasmid (a Kras-Src FRET biosensor, Addgene), (ii ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid was created by adding the rtTA with a 2A peptide to the Puromycin resistance gene in a CMV Puro DEST plasmid (Addgene) by gibson cloning41 ...
-
bioRxiv - Cell Biology 2021Quote: ... Source of different elements are as follows: LAMP1 signal peptide and human LAMP1 were PCR amplified from LAMP1-mGFP (Addgene Plasmid #34831 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified and cloned red shifted Luc gene downstream of MNDU3 promoter and linked via 2A peptide to florescent protein encoding gene which were amplified from Addgene plasmids 48249 (mWasabi) ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... WT SpCas9 flanked by two nuclear localization signals linked to a blasticidin-S-deaminase – mTagBFP fusion protein via a self-cleaving peptide (derived from lenti-dCAS9-VP64_Blast, a gift from Feng Zhang, Addgene #61425). Following blasticidin selection ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing its endogenous intron were fused upstream of 2A self-cleaving peptide and eGFP and cloned into an MSCV vector (PIG, Addgene) [100] ...
-
bioRxiv - Molecular Biology 2023Quote: For pseudotyping rVSV-ΔG*RenLuc with rabies spike protein the residues 1 - 485 including the ecto- and transmembrane domains but excluding the cytoplasmic tail of RABV-G (ERA strain, UniProtKB ID: P03524.1, residue numbering includes signal peptide) were cloned into pEBB vector (Addgene #22226), resulting in plasmid pEBB-R0CT ...
-
bioRxiv - Biophysics 2019Quote: ... ZapA-LPETG was incubated with 0.5 mM of labelled peptide GGGC-Cy5 and 10μM Sortase 7M (purified using pET30b-7M SrtA, a gift from Hidde Ploegh, Addgene plasmid #51141) in a final concentration of 50 μM ...
-
bioRxiv - Plant Biology 2021Quote: ... vector was modified to tie resistance marker gene expression directly to Cas9-Nlux expression by the P2A peptide linker to generate the plasmid pNOC-ARS-CRISPR-P2A-BlastR (Addgene: 98147). The P2A-BlastR fragment was amplified from pNOC-ARS-destiny-P2A-BlastR-GFP (Poliner et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125) in place of the CD19-specific scFv ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Synthetic Biology 2020Quote: The Sav library was created based on a previously described expression plasmid that contains a T7-tagged Sav gene with an N-terminal ompA signal peptide for export to the periplasm under control of the T7 promoter in a pET30b vector (Addgene #138589)34 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Cell Biology 2023Quote: A synthetic sequence corresponding to 2A peptide from Thoseaasigna virus capsid protein and BspTI (AflII) restriction site was first cloned to pCXLE-EGFP (Plasmid #27082, Addgene, www.addgene.org) (Okita et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV capsid AAV1-X1 was built by inserting a 7-mer peptide between AAs 588-589 of the AAV1 cap gene in AAV1-Rep-Cap (Challis et al. 2019) (Addgene 112862).
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Plant Biology 2024Quote: ... together with a fragment containing the nucleotides encoding for the Pip1 pro-domain but lacking the signal peptide (pJK110; Supplemental Table S4) were combined in all 64 possible combinations with pICH41264 (Addgene #4799; Weber et al., 2011) in a BpiI Golden Gate reaction (Supplemental Table S4) ...