Labshake search
Citations for Addgene :
401 - 450 of 980 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2019Quote: ... by PCR and subcloning the product into the pENTR1A-GFP-N2 vector (Addgene # 9364) at the HindIII and BamH1 restriction sites ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Plant Biology 2021Quote: ... Gel-purified PCR product and SspI-digested pET-His6-MBP-TEV-LIC vector (Addgene) were treated with T4 DNA polymerase with 25 mM dCTP and dGTP for 30 min at 22°C followed by heat inactivation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was subcloned into pJFRC19-13XLexAOP-IVS-myr::GFP vector (Addgene#26224) to generate pJFRC19-13XLexAOP-yki3S/A ...
-
bioRxiv - Genetics 2022Quote: ... mouse cGAS was amplified via PCR from a pMSCVpuro-eGFP-cGAS template (Addgene, 108675) using primers containing KpnI and NotI restriction sites (S1 Table) ...
-
bioRxiv - Microbiology 2020Quote: ... dTomato gene was amplified by PCR from pLenti-V6.3 Ultra-Chili (Addgene plasmid # 106173) using primers dTomato_F_EEV and dTomato_linker_R_BH ...
-
bioRxiv - Molecular Biology 2021Quote: ... iRFP720 was obtained by PCR from iRFP720-N1 (gift from Vladislav Verkhusha, Addgene #45461).
-
bioRxiv - Neuroscience 2021Quote: ... TVA-mCherry was amplified by PCR from a plasmid (gift from Dr. Uchida, Addgene plasmid #38044 ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Cell Biology 2022Quote: ... Strep-KDEL was PCR amplified from Strep-KDEL-SBP-mCherry-GPI (Addgene plasmid #65295) and assembled to a BamHI/PsrI digested TtTMPV-Neo viral backbone (Addgene plasmid #27993) ...
-
bioRxiv - Genomics 2019Quote: ... The dLbuCas13 gene was amplified by PCR from the Lbu_C2c2_R472A_H477A_R1048A_ H1053A plasmid (Addgene #83485). The ADAR1DD (hyperactive E1008Q variant ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Cell Biology 2019Quote: ... and TIR1 sequence were amplified by PCR from pcDNA5-EGFP-AID-BubR1 (Addgene #47330) and pBABE TIR1-9Myc (Addgene #47328)30 plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... sequences were amplified by overlap PCR and subcloned into the AAV-CAG-GFP (Addgene) at BamHI and EcoRI ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The LOV2 domain was PCR amplified from the vector CMV-CASANOVA (Addgene plasmid #113035) previously reported by us (29) ...
-
bioRxiv - Cancer Biology 2019Quote: ... the KRAB domain was PCR amplified using pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911) as a template ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... and 1039–1176) were PCR-amplified using the full-length Prdm16 plasmids (Addgene #15503) and sub-cloned into XbaI/EcoRI sites of Flag-HA-pcDNA3.1 vector (Addgene #52535) ...
-
ER exit sites in Drosophila display abundant ER-Golgi vesicles and pearled tubes but no megacarriersbioRxiv - Cell Biology 2021Quote: ... the APEX sequence was PCR-amplified from plasmid pcDNA3 APEX2-NES (Addgene, cat # 49386) with primers attNheIAPEX-F and attSpeIAPEX-R adding att sites ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplified ScTop2 and HsTOP2α cDNAs were inserted into the 12URA-B (Addgene #48304) yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305 ...
-
bioRxiv - Cell Biology 2022Quote: ... OMP25 was PCR amplified from paGFP-Omp25 (gift from D. Sabatini, Addgene plasmid #69598) and cloned with XhoI/BamHI into mMaple-C1 ...
-
bioRxiv - Cell Biology 2022Quote: ... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... GB was PCR amplified from GB-NES (gift from R. Campbell, Addgene plasmid #61017) (Ding et al. ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was constructed by PCR amplifying the sacB gene of pACRISPR (Addgene plasmid #113348) (Chen et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... EXO1 was PCR amplified from pTXB1-EXO1b (Addgene #68267 (El-Shemerly et al., 2005)) and transferred directly into pCW57.1 using Gibson Assembly.
-
bioRxiv - Molecular Biology 2022Quote: ... The M-MLV* reverse transcriptase in ciPE2 was PCR-amplified from pCMV_PE2 (Addgene #132775), a gift from David Liu ...
-
bioRxiv - Molecular Biology 2022Quote: ... The deaminase components in ciABEmax and ciABE8e were PCR-amplified from pCMV_ABEmax (Addgene #112095) and pCMV_ABE8e (Addgene #138489) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The CDS for AGO1 and GW182 were PCR amplified from pAFW-Ago1 (Addgene #50553) and LD47780 (DGRC ...
-
bioRxiv - Microbiology 2023Quote: ... The backbone vector pLVX-EF1alpha-2xStrep-IRES-Puro was linearized by PCR from Addgene plasmid # 141395 with primers pLVX-EF1alpha_Fw (ctcgaaggcggcggg ...
-
bioRxiv - Cancer Biology 2023Quote: Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA templates for PCR products were as follows - myo-3p from pCFJ104 (Addgene #19328), pgl-1::GFP::FLAG from DUP75 (Andralojc et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Canada) was amplified by PCR and inserted into the retroviral vector pBABE-puro (Addgene) containing the puromycin-resistance gene and the MoMuLV LTR promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... The corresponding PCR product was subsequently cloned into linearised tdTOMATO-C1 plasmid (Addgene #54653), before transfected into ECs by electroporation.
-
bioRxiv - Genomics 2023Quote: ... and the URA3 cassette was amplified by PCR from plasmid pWS158 (Addgene plasmid #90517). The amplified DNA fragments ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using a plasmid VCP (wt)-EGFP gifted from Nico Dantuma (Addgene plasmid # 23971 ...
-
bioRxiv - Cell Biology 2023Quote: ... the H2B-mRFP1 sequence was amplified by PCR from pLV-RFP (Addgene #26001 (39)) and inserted using Gibson assembly in place of GFP into vector pEGFP-C1 (Clonetech ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The first fragment came from PCR amplification of pETM6-HCAmp-EV (Addgene Cat#49795) with primers JNH13 and JNH14 ...
-
bioRxiv - Cancer Biology 2023Quote: The LIG1 open reading frame (ORF) was amplified by PCR from pDONR223_LIG1_WT_V5 (Addgene, 83006) and cloned into the pOZ-FH-C vector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... FusionRed-PixD and Citrine-PixE were produced by PCR using existing templates (Addgene #31181), (Addgene #111503 ...
-
bioRxiv - Biochemistry 2023Quote: ... Then PCR products were Gibson-cloned into the PEmax mRNA plasmid (Addgene plasmid #204472) digested with RsrII and XhoI enzymes ...
-
bioRxiv - Neuroscience 2024Quote: ... pCAG 4xmt-iATPSnFR1.0 was created by PCR of the DNA encoding iATPSnFR1.0 from Addgene Plasmid #102556 (a gift from Baljit Khakh) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... pCR-U6-gRNA-miniCMV-TdTomato was generated by inserting miniCMV-TdTomato from reporter-gT1 (Addgene plasmid #47320 ...
-
bioRxiv - Developmental Biology 2021Quote: ... to insert PCR-amplified genomic regions into the VanGlow vector with the DSCP (Addgene#83338). The various transgenic reporters were integrated into the VK31 site on chromosome 3 using φC31-mediated integration (Bischof and Basler ...
-
bioRxiv - Neuroscience 2021Quote: ... TOPO-cloned the PCR products into pENTR-D-TOPO and transferred to pBPGUw (Addgene #17575) using standard Gateway cloning ...
-
bioRxiv - Neuroscience 2019Quote: ... We used PCR to amplify GFP from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (JFRC, Addgene) and added an AgeI site to the reverse primer ...
-
bioRxiv - Biochemistry 2019Quote: ... Entry clones were produced by PCR amplification of portions of the NF1 gene from Addgene construct 70423 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR of mNG-GECO variants were ligated into Tol2-HuC-H2B vector (Addgene plasmid #59530) cut with SalI/AgeI using Gibson Assembly ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the T7RNAPK276R sequence was PCR amplified from plasmid pRS315-nls-T7-RNAP (Addgene plasmid #33152) (30 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...