Labshake search
Citations for Addgene :
201 - 250 of 1003 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The sfgfp gene was PCR-amplified with primers 35 and 36 from plasmid pHR-scFv-GCN4-sfGFP-GB1-NLS-dwPRE (gift from Ron Vale; Addgene plasmid # 60906 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Plant Biology 2022Quote: ... a 4.5 kb genomic region upstream of the first annotated ATG in the ATM1 gene was amplified using gene specific primers and ligated into pENTR5’ (Plasmid 27320; Addgene) to create plasmid pDO#22 (pENTR5’-ATM1pro (4.5kb)) ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Plant Biology 2023Quote: The full-length or 3TPR-truncated cDNA sequence of SPY was amplified from Arabidopsis cDNA with appropriate primers (listed in Supplemental Table 1) and cloned into the pET28sumo vector (Addgene?), which adds a 6xHis-SUMO tag to the N-terminus of the protein of interest ...
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector (Dickinson et al., 2013) (a gift from Bob Goldstein (Addgene plasmid # 66823 ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genetics 2021Quote: ... DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction47 or using a plasmid template (Addgene #4223048) and appropriate primers46 ...
-
bioRxiv - Molecular Biology 2021Quote: ... This plasmid was used as a template for PCR and 2500ng of purified HDR template PCR product combined with 1500ng of guide RNA expression plasmid (Addgene 49330) containing the guide RNA listed in Table S4 were co-transfected into OSCs ...
-
bioRxiv - Genomics 2023Quote: ... We further replaced the Cas9 cassette with an nCas9/M-MLV-RT cassette from the pCMV-PE2 plasmid (Addgene, 132775). The lentiV2-pegRNA and lentiV2-ngRNA plasmids were constructed by replacing the Cas9 and Puromycin sequences in the lentiCRISPR v2 plasmid (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products were ligated into lentiCRISPR v2 (Addgene, 52961) using Gibson Assembly® Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry was PCR amplified from Cas9-mCherry (Addgene #78313) and cloned into the BamHI site ...
-
bioRxiv - Cancer Biology 2020Quote: ... which was PCR-amplified from pEMS1384 (Addgene Plasmid #29304). The pHes5-d2EGFP plasmid was a gift from Ryoichiro Kageyama (Ohtsuka et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplified and cloned into lentiCRISPRv2 (Addgene Plasmid #52961) and lentiGUIDE-puro (Addgene Plasmid #52963 ...
-
bioRxiv - Neuroscience 2020Quote: ... we first PCR amplified the OXTR sequence (Addgene, #66467) to contain ClaI restriction enzyme sites at each end ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Biophysics 2020Quote: Full length HP1α was amplified by PCR (Addgene 17652), and cloned using InFusion kit into a pHR lentiviral vector under an SFFV promoter and tagged C-terminally with mCherry and sspB ...
-
bioRxiv - Cell Biology 2022Quote: ... mApple and sfCherry2 cDNAs were PCR-amplified from Addgene plasmids #54862 and #83031 ...
-
bioRxiv - Molecular Biology 2022Quote: ... one obtained by PCR on pRPR1_gRNA_handle_RPR1t (Addgene Plasmid #49014) using OFS_2869 and OFS_2870 oligonucleotides ...
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biochemistry 2021Quote: A PCR product from plasmid pDD282 (Addgene plasmid # 66823) was used as a donor template for insertion of gfp ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were subcloned into the pUC19 plasmid (Addgene) and sequenced.
-
bioRxiv - Molecular Biology 2022Quote: ... PUM1 was PCR amplified from pMAL-PUM1 (Addgene #120384) and PUM2 was PCR amplified from pMAL-PUM2 (Addgene #120385) ...
-
bioRxiv - Microbiology 2020Quote: ... the human hACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Neuroscience 2020Quote: ... we PCR-amplified the CEPIA coding region from Addgene plasmids pCMV CEPIA3mt and pCMV CEPIA4mt (Suzuki et al ...
-
bioRxiv - Cell Biology 2021Quote: ... KAP1 was PCR amplified from pEGFP-KAP1 (Addgene, #45568) and inserted in place of PMLIII into pBOS-PMLIII-YFP plasmid.
-
bioRxiv - Genetics 2022Quote: ... Gata6 cDNA was PCR amplified from pSAM2_mCherry_Gata6 (Addgene #72694) and ligated using InFusion cloning.
-
bioRxiv - Systems Biology 2024Quote: ... PpHIS4 gene was PCR amplified from pMJA089 (Addgene #128518) (Yang et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... two guideRNAs were designed to flank the target exon coding the β1-2 loop (see Table EV1 for primer sequences) and cloned into the guide RNA expression pCFD4 vector (Addgene #49411). The exon of interest and homology arms were cloned into donor template plasmid pHD-ScarlessDsRed (Addgene # 64703 ...
-
bioRxiv - Cell Biology 2019Quote: ... mTFP1-NMIIB was generated by amplification of NMIIB coding sequence using primers ICCP170 and ICCP171 inserted into mTFP1-NMIIA (Addgene #55501) replacing NMIIA ...
-
bioRxiv - Developmental Biology 2019Quote: ... using AscI and NotI-containing primers and cloned the fragment into the vector p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open] (Addgene plasmid #71809). Transgenic lines were generated by Genetivision Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: We amplified MPro with an N-terminal KTSAVLQ sequence using two primers FRET-Mpro-for and FRET-Mpro-rev primers (Table S1) and cloned it into the pECFP-18aa-EYFP plasmid (Addgene, #109330) between XhoI and HindIII restriction sites to afford pECFP-MPro-EYFP ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers containing this targeting sequence (primers 11 and 12) were annealed and subcloned into the pU6-(BbsI) CBh-Cas9-T2A-mCherry vector (Addgene #64324) digested with BbsI.
-
bioRxiv - Cell Biology 2022Quote: ... T2A-GFP fragment was amplified by T2A-F and GFP-R primers using plenti-CMV-mCherry-T2A-GFP (Addgene plasmid #109427) as a template ...
-
bioRxiv - Molecular Biology 2020Quote: ... The YAP5SA gene was amplified with primers YAP1-5SA-Str-BglII and YAP1-5SA-End-SalI using pQCXIH-Myc-YAP-5SA (Addgene #33093) as a template and ligated into the pAAV-CMV plasmid ...
-
bioRxiv - Genomics 2019Quote: ... These primers amplify both candidate enhancers and previously assigned degenerate barcodes and add homology arms to the ORI vector (Addgene 99296)25 ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Plant Biology 2022Quote: ... AA106 and AA107) and mNeonGreen (primer pair: AA108 and AA109) were amplified from Zea mays B73 cDNA and mNeonGreen-2A-mTurquoise2 (Addgene #98885), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... with a PCR product containing a T2A-HygR cassette that was amplified using primers 3551/3552 and template lenti MS2-P65-HSF1_Hygro (Addgene Plasmid #61426). The initial control insert shRNA NT control #4 was replaced by digesting pZIP-ZsGreen-T2A-Hyg-shNT4 with NotI and MluI and inserting miR-30-based shRNAs for cFLIP (sh1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2xP4M-SidM was first amplified using P3 and P4 primers and GFP:P4M-SidM2x (a gift from Prof. Tamas Balla, Addgene plasmid # 51472) as a template and introduced into the vector pHD22 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...