Labshake search
Citations for Addgene :
551 - 600 of 960 citations for hsa mir 146a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was digested with EcoRI and ligated into EcoRI digested pHR-SFFV-KRAB-dCas9 vector (Addgene, 60954), to generate a pHR-pTRE3G-KRAB-dCas9 vector ...
-
bioRxiv - Neuroscience 2019Quote: ... The T2A-GFP sequence was amplified by PCR using plasmid PX461 (a gift from Feng Zhang; Addgene plasmid #48140) as template and inserted into the intermediate plasmid at HindIII site to generate pAAV-hSyn-FLPo-T2A-GFP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283433) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus ...
-
bioRxiv - Cell Biology 2020Quote: The gRNAscaffHygroR vector was constructed by PCR amplification of the Hygromycin resistance gene from pBABE-hygro-hTERT (Addgene # 1773) plasmid and cloning into the EGFP_SV40PA vector downstream of the OmEF1a promoter followed by the modified guide RNA scaffold sequence PCR amplified from gRNA_GFP-T2 (Addgene # 41820).
-
bioRxiv - Neuroscience 2019Quote: GFP-progerin cDNA was PCR amplified from the pBABE-puro-GFP-progerin plasmid (Addgene, 17663 deposited by Tom Misteli) using primers (forward 5’-GATCATCGATATGGTGAGCAAGGGCGAGGAG-3’ ...
-
bioRxiv - Biochemistry 2020Quote: BsaI sites and compatible overhangs were added by PCR amplification of cpGFP from pTKEI-Mal-B2 (Addgene Plasmid #79756) using primers cpGFP-BsaI-GG-F and cpGFP-BsaI-GG-R ...
-
bioRxiv - Cell Biology 2021Quote: ... the open reading frames of mTagBFP2 and mNeongreen2 were amplified by PCR from donor vectors pBAD-mTagBFP2 (Addgene #34632) and pSFFV_mNG2(11)1-10 (Addgene #82610) ...
-
bioRxiv - Microbiology 2021Quote: ... the human ACE2 coding sequence (RefSeq accession NM_001371415.1) was PCR amplified and cloned into the BamHi site of lentiviral vector pHR-PGK (Addgene #79120). Lentivirus was produced as described above and used to transduce 5×104 target cells (A549 ...
-
bioRxiv - Systems Biology 2020Quote: ... and S415A) were introduced using the delitto perfetto method (Stuckey et al., 2011) using the PCR-amplified pCORE cassette (RRID:Addgene_72231) to integrate selective markers at the endogenous gene loci ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet-i-H2A construct was amplified by PCR from pmScarlet-i_H2A_C1 (a gift from Dorus Gadella, Addgene plasmid #85053) (Bindels et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... the EB3-tdTomato fragment was amplified by PCR from EB3-tdTomato (a gift from Erik Dent, Addgene plasmid #50708) (Merriam et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... TVA-mCherry was amplified by PCR from a plasmid (gift from Dr. Uchida, Addgene plasmid #38044 ; http://n2t.net/addgene:38044 ; RRID:Addgene_38044, ref43) and inserted into a 5xUAS vector34.
-
bioRxiv - Developmental Biology 2022Quote: ... 100µl of the ESCs were then mixed with the scCRISPR construct (Composition: 10µl elute of HDR PCR product; 1µl sgPal7 (Addgene, 71484); 1µl spCas9-BlastR (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... NTR candidates were PCR amplified and cloned into the NdeI and SalI sites of two plasmids: pUCX (Addgene #60681), for biological overexpression assays ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Cell Biology 2019Quote: ... The enhanced green fluorescent protein (EGFP) sequence was amplified via PCR from a pcDNA3-EGFP plasmid that was a gift from Doug Golenbock (RRID:Addgene_13031). The EGFP sequence was cloned in-frame on the N-terminus of TMEM135 in the pTarget vector using BamHI and XhoI restriction enzymes ...
-
bioRxiv - Biochemistry 2021Quote: pGN002: The ECFP encoding fragment was amplified by PCR using primers GNCA005 and GNCA006 (on pcDNA3-CFP, Addgene #13030), followed by DpnI treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... guide sequences were PCR amplified from a CustomArray Inc oligo pool and cloned into the lentiGuide-Puro (Addgene #52963) backbone using Golden Gate cloning ...
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... and the cDNA of CRY2PHR was PCR amplified from the pCRY2PHR-mCherryN1 plasmid from the Tucker Lab (Addgene 26866) (7) ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2021Quote: A construct encoding residues 109-492 comprising soluble TMPRSS2 ectodomain was amplified by two PCR fragments (Addgene plasmid# 53887) and subcloned into the pFHMSP-LIC C donor plasmid by LIC method ...
-
bioRxiv - Microbiology 2020Quote: ... the human ACE2 gene (Miaolingbio #P5271) was PCR-amplified and cloned into the pLV-EF1a-IRES-blast (Addgene #85133). The human TMPRSS2 and DPP4 gene (Sino Biological #HG13070-CM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Flag-hHOXA1 (pchHOXA1-3XFlag-myc) and Flag-mHoxA1 (pcmHoxa1-3XFlag-myc) were generated by cloning PCR-amplified inserts into a pcDNA3.1 vector (Addgene) featuring a 3XFlag-myc tag sequence in the multiple cloning site ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA sequence encoding the T7 RNA polymerase promoter and sgRNA was amplified by PCR from pHelper_ShCAST_sgRNA vector (Addgene, #127921). The DNA template was then subjected to GeneJet PCR purification (ThermoScientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histone H2A cDNA were PCR amplified from pCDNA3.1-Flag-H2A and pCDNA3.1-Flag-H2A K118-119R51 (Addgene, #63560, #63564). Histones Macro-H2A cDNAs were obtained for the DKFZ cDNA clone repository.
-
bioRxiv - Immunology 2022Quote: ... pTRIP-hPGK-STING-TurboID was cloned by Gibson assembly of PCR amplified TurboID from V5-TurboID-NES_pCDNA3 (Addgene #107169) and STING from pTRIP-CMV-STING-GFP ...
-
bioRxiv - Plant Biology 2022Quote: ... The LacZ selection marker was PCR amplified with flanking BsaI sites into Level 1 acceptor vector pICH41780 (Addgene #48019) to allow blue-white screening for successful gRNA insertion into final ABE vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This fragment was subcloned with the above PCR fragment using Gibson enzymatic assembly (Gibson et al. 2009) to generate PRE-Hsp70BbCas9_1.0 (Addgene 190795). Gypsy insulator elements were subsequently cloned into PRE-Hsp70BbCas9_1.0 through two Gibson cloning events to generate PRE-Hsp70BbCas9_1.2 (Addgene 190796 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the dFMRP CDS was PCR amplified from pAc5.1-EGFP-dFMRP and transferred into pET-His6-MBP-TEV (Addgene #29656) by ligation-independent cloning following QB3 Macrolab protocols (https://qb3.berkeley.edu/facility/qb3-macrolab/) ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2023Quote: ... each of these systems was PCR amplified and cloned into pTNS2 to replace the parental mini-Tn7 (Addgene #64968) by Golden Gate assembly ...
-
bioRxiv - Developmental Biology 2023Quote: ... was cloned with Gibson assembly in frame with the SV40pA sequences that were PCR amplified from lentiCRIPSRv2 (Addgene, #52961). Gibson cloning was subsequently used to simultaneously encompass digested 8xtetO-EF1a promoter-eGFP-SV40pA cassette in frame with the homology arms and the whole insert was cloned into the pSMART-HCKAN (Lucigen ...
-
bioRxiv - Biochemistry 2023Quote: ... at AgeI and NheI sites and fusing PCR amplified CIB1 and spTN (Addgene plasmid # 153002, (Cho et al., 2020a)) using Gibson assembly ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... PCR was used to amplify the U6-crRNA scaffold and the DiCas7-11 gene sequence from pDF0114 (Addgene #172508) and pDF0159 (Addgene #172507) ...
-
bioRxiv - Bioengineering 2023Quote: ... The Sp sgRNA plasmids were obtained through PCR- site directed mutagenesis of p426- SNR52p-gRNA.CAN1.Y-SUP4t (Addgene 43803) to introduce the target sequences ...
-
bioRxiv - Developmental Biology 2023Quote: ... These sites were subsequently used to introduce the PCR product into linearized pmiRFP670-N1 plasmid (Catalog no.79987, Addgene) using T4 DNA Ligase (Catalog no ...
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Biochemistry 2023Quote: ... This PCR product was digested with BamHI and BsrGI and cloned into pET-21a-PEmax-6His (Addgene plasmid #204471) digested with the same enzymes ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry ORFs were amplified by PCR using pFa6a-mEGFP-kanMX6 (a gift from Julien Berro72, Addgene plasmid # 87023), pAS1NB (a gift from Mark Prescott35 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting pU6-chiRNA cassette was amplified by PCR and inserted into the pnos-Cas9-nos plasmid (Addgene #62208) at the NheI restriction site ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragment was subcloned in the BamHI and NotI site of pET-28a+GFP-CAMSAP1 CKK (Addgene #59033), which contains 6 histidine (His ...
-
bioRxiv - Cancer Biology 2019Quote: The CRISPR kit used for constructing multiplex CRISPR/Cas9 vectors was a gift from Takashi Yamamoto (Addgene kit #1000000054). Guide RNAs targeting LRP5 and LRP6 were designed using the Zhang Lab Optimized CRISPR Design Tool (http://crispr.mit.edu) ...
-
bioRxiv - Plant Biology 2022Quote: ... a modular cloning system was employed using MoClo Tool Kit and MoClo Plant Parts kit (Addgene, Supplemental Table S3) (Weber et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... the kit (Golden Gate TALEN and TAL Effector Kit 2.0) consisting of 86 library vectors was ordered from Addgene (www.addgene.org). To assemble the dTALe harboring 16 repeats ...
-
bioRxiv - Plant Biology 2020Quote: ... The following binary plasmids were assembled by Golden Gate cloning using the MoClo Tool Kit for plants (Addgene kit #1000000044) (Weber et al. ...
-
bioRxiv - Bioengineering 2022Quote: Cas9 and FE expression vectors were constructed using the pX330A and pX330S vectors contained in Multiplex CRISPR/Cas9 Assembly System Kit (Kit #1000000055, Addgene)48 with some modifications ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-APEX plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and APEX from pcDNA3 APEX-nes (Addgene) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...