Labshake search
Citations for Addgene :
201 - 250 of 487 citations for Zinc Finger Protein 50 ZNF50 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... A VSV G protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABAergic projection neurons in the basal forebrain were retrogradely labeled using a unilateral injection of AAVrg-hSyn-DIO-eGFP in the OB (50 nL, Catalog #50457-AAVrg, Addgene), guided with a stereotaxic apparatus (Kopf ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Genetics 2019Quote: ... Guide sequences with an aggregate score of greater than 50% were selected and cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene) or pSpCas9(BB)-2A-RFP (modified from PX458 ...
-
bioRxiv - Neuroscience 2019Quote: In some PV-IRES-Cre mice ChR2 was introduced by injecting 50 nL of AAV2/5-hSyn1-FLEX-hChR2-tdTomato (Addgene plasmid 41015 ...
-
bioRxiv - Neuroscience 2019Quote: ... These fragments were combined using overlap extension PCR [115] and the final PCR product was injected into N2 worms at a concentration of 50 ng/μL along with pCFJ90 (Pmyo-2::mCherry) (AddGene) at a concentration of 2 ng/μL as a transgenesis marker ...
-
bioRxiv - Neuroscience 2019Quote: ... Constructs were injected into N2 worms at a concentration of 20-50 ng/μl along with Punc-121::RFP (AddGene) at a concentration of 100 ng/μl as a transgenesis marker to bring the final concentration up to 150 ng/μl ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 100 ng of the indicated ORF6 expression construct along with either 50 ng of an ER marker (eGFP-Calnexin; Addgene: 57122), 50 ng of a Golgi marker [mTag-β-galactosidase (1-61)] ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant WNK1 kinase domain was eluted via addition of 50 nM bdSENDP1 protease (Frey et al., 2014; Addgene ID 104962) in wash buffer 4.
-
bioRxiv - Cancer Biology 2020Quote: Cells were plated in 24-well plates and transfected with YAP/TAZ luciferase reporter 8XGTIIC-lux plasmid (50 ng/cm2) (Addgene 34615) together with CMV-lacZ (75 ng/cm2 ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected 50-100 nL of AAV (AAV2/1-Syn-jGCaMP8m-WPRE, Addgene #162375 or AAV2/1-Syn--GCaMP6s-WPRE-SV40, Addgene #100843) either in the AC in two locations (Coordinates ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Lentiviral particles for CEBPB knockdown were generated by transfecting shRNA plasmids (TRCN0000007440 and TRCN0000007442) or scramble shRNA control (a gift from David Sabatini; Addgene_1864 [50]), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Genomics 2023Quote: ... Lentivirus containing the landing pad sequence was produced by co-transfecting 293T cells at ∼50% confluence with psVSV-G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Neuroscience 2021Quote: ... solution carrying the jGCaMP7s gene under the human synapsin promoter (AAV1-hsyn-jGCaMP7s, ~1e12 GC/ml, 50 nl in each injection spot, Addgene plasmid #104487) was injected into the visual ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2000 ng total plasmid DNA per dish including the 50-1000 ng FP-tagged encoding plasmids supplemented with an empty plasmid vector (pCAG-FALSE, Addgene plasmid #89689) depending on the aimed fluorescence level [35] ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNA expression construct containing the target sequence 5’-GGTTTGGTTGATTTCTGCAC-3’ was obtained using a PCR-fusion technique and the PCR product was injected at 15 ng/μL together with 50 ng/μL pDD162 (eft-3prom::Cas9, a gift from Bob Goldstein, Addgene plasmid #47549). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... and neurons were sorted based on labeling the cell type of interest with pAAV-CAG-tdTomato for 24 hours prior to incorporation into miBrain or monoculture (1:50 dilution, Addgene 59462-AAV1).
-
bioRxiv - Cell Biology 2023Quote: Donor plasmid encoding homology arms and linker-mEGFP sequence for C-terminus tagging of human NPM1 was designed by the Allen Institute for Cell Science and obtained from Addgene (AICSDP-50). The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122) ...
-
bioRxiv - Microbiology 2024Quote: A doxycycline-inducible CRISPR/Cas9 expression vector (pSBtet-puro-Cas9-U6) was generated by cloning the Cas9-U6 portion of pX459 (Addgene #62988; [49] into pSBtet-pur (Addgene #60507; [50]). Cas9 was first cloned into pSBtet-pur using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...