Labshake search
Citations for Addgene :
1 - 50 of 770 citations for Yellow Fever Virus NS1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... eiF4E6(GGGGATCCGCCGAACAAGGG) or Yellow (Addgene #49331) guide sequences were inserted ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Neuroscience 2023Quote: ... and pZac2.1 gfaABC1D-lck-GCaMP6f virus (Addgene virus #52924).
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Neuroscience 2020Quote: ... The virus (Addgene plasmid pAAV-hSyn-Flpo ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV-CamKII-Cre virus (Addgene) was diluted 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was obtained from Addgene. During surgery ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus pAAV.CAG.GCaMP6s.WPRE.SV40 (Plasmid #100844, Addgene) was injected into the plantar area of the hindpaw using a 10 μl Hamilton syringe with a cannula connected to a 30G needle ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Neuroscience 2022Quote: ... The GCaMP6 virus (AAV1.Syn.Flex.GCaMP6s.WPRE.SV40, Addgene; titre ...
-
bioRxiv - Neuroscience 2022Quote: ... The virus was produced by Addgene or the Virus Facility of the University Medical Center Eppendorf ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated virus AAV5.CamKII.GCaMP6f.WPRE.SV40 (Addgene # 100834 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-packaged constructs (Addgene, virus # 107790) expressed GCaMP6s under the CaMKIIα promoter to achieve pyramidal cell-predominant expression (Wood et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1.CaMKIIa.hChR2(H134R)-eYFP.WPRE.hGH virus (Addgene) was infused bilaterally in the infralimbic cortex (IL ...
-
bioRxiv - Neuroscience 2023Quote: Adeno-associated virus AAV5.CamKII.GCaMP6f.WPRE.SV40 (Addgene # 100834 ...
-
bioRxiv - Neuroscience 2024Quote: ... virus and pAAV.CAG.LSL.tdTomato (Addgene, stock #100048) virus ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received injections of either hM4Di virus or a control virus (pAAV-S5E2-GFP; Addgene #135631-AAV1). The hM4Di virus was derived from Addgene plasmid 83896 ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus (AAV) vector expression imaging of enhanced green fluorescent proteins (eGFP): Stereotaxic injection of AAV8-CAG-GFP (Addgene ID ...
-
bioRxiv - Neuroscience 2022Quote: ... 250nl of an anterograde adeno-associated virus (AAV) vector expressing a green fluorescent protein under the hSyn (human synapsin) promoter (AAV5-hSyn-eGFP; Addgene) was injected into ACC to fluorescently mark the anatomical boundary of the claustrum (White et al. ...
-
bioRxiv - Neuroscience 2019Quote: AAV1-Cre virus was obtained from Addgene (pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 ...
-
bioRxiv - Neuroscience 2020Quote: ... GCaMP6s virus (pAAV.Syn.DIO.GCaMP6s.WPRE.SV40) was obtained from Addgene, Rabies-EGFP virus (EnvA G-deleted Rabies-EGFP ...
-
bioRxiv - Neuroscience 2022Quote: ... the AAV9.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, MA, USA) was added to the cultures at a final concentration of 1 μl/mL for GCaMP6f expression ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-DIO-GCaMP7s virus from Addgene #104491-AAV1 110 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... The hM4Di virus was derived from Addgene plasmid 83896 ...
-
bioRxiv - Microbiology 2020Quote: ... Vesicular stomatitis virus G protein (VSV-G) pseudotyped lentiviruses expressing human ACE2 were produced by transient co-transfection of pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Cell Biology 2023Quote: A synthetic sequence corresponding to 2A peptide from Thoseaasigna virus capsid protein and BspTI (AflII) restriction site was first cloned to pCXLE-EGFP (Plasmid #27082, Addgene, www.addgene.org) (Okita et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV9 CaMKII-eGFP (3.45×10^12 virus molecules/mL)(Penn) or AAV5-hDlx-ChR2-mCherry (7.6 ×10^14 virus molecules/mL) (Addgene plasmid # 83898 ...
-
bioRxiv - Microbiology 2020Quote: ... and the matrix protein from vesicular stomatitis virus was amplified from pVSV eGFP dG (a gift from Connie Cepko; Addgene plasmid #31842) as described above using the primers listed in Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: Time-pregnant wild-type C57BL/6J female mice underwent in utero virus injection of CamkII-cre virus (105558-AAV1, Addgene) into the left side of the lateral ventricles ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV8-CaMKIIa-hM4D(Gi)-mCherry virus (hM4D) (Addgene) or a control virus under the same promoter ...
-
bioRxiv - Neuroscience 2020Quote: The virus (pAAV.Syn.GCaMP6f.WPRE.SV40, Addgene viral prep # 100837-AAV1) (Chen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 250 nl pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, 100833-AAV1, RRID:Addgene_100833) was injected into mitral cell layer at both 200 µm and 300 µm depths (Chen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 250 nl pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (Addgene, 100833-AAV1, RRID:Addgene_100833) was injected into mitral cell layer at both 200 µm and 300 µm depths (Chen et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... an AAV-CaMKII-cre virus (Addgene/Penn Vector) was injected into cortex (viral titer ...
-
bioRxiv - Neuroscience 2021Quote: The virus (pAAV.Syn.GCaMP6f.WPRE.SV40, Addgene viral prep # 100837-AAV1)42 was delivered using a Picospritzer III (Parker ...
-
bioRxiv - Neuroscience 2021Quote: ... an AAV-CaMKII-cre virus (Addgene/Penn Vector) was injected into barrel cortex (1:10k-1:50k dilution ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-S5E2-dTom-nlsdTom virus (Addgene number: 135630) was packaged by the Janelia Vector core with AAV2/9 serotype (virus titer after 1:1 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... an AAV-CaMKIIa-eGFP virus (Addgene; 50469-AAV5) was injected into the adult hippocampus of CTRL and CKO mice.
-
bioRxiv - Cancer Biology 2021Quote: ... The virus package plasmids psPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...