Labshake search
Citations for Addgene :
51 - 100 of 127 citations for UDP β L Arabinofuranose since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Developmental Biology 2022Quote: ... pCXLE-L-MYC-F2A-LIN28 (ML, Addgene ID 27080), pCXLE-hOCT4-shTP53 (Addgene ID 27077) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Genetics 2023Quote: ... by co-transfecting cells with TALEN-L (Addgene #35431), TALEN-R (Addgene #35432 ...
-
bioRxiv - Cell Biology 2020Quote: ... Wild-type β-PheRS cDNAs were cloned into the pET LIC (2A-T) plasmid (Addgene). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... Flag-KD-IKKβ (K44M) (Cat# 11104) and HA-β-TrCP2 (Cat# #36969) were from Addgene. Flag-CA-IKKα (S176E ...
-
bioRxiv - Neuroscience 2024Quote: ... containing AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837 (44)) and AAV9-CAMKII-mScarlet-C1V1-KV2.1 (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2020Quote: ... and β-Actin DNA (Actin mRFP-PAGFP was a gift from Guillaume Charras & Tim Mitchison, RRID:Addgene_62382) into the third-generation lentiviral plasmid pCDH-EF1-IRES-Puro (System Biosciences).
-
bioRxiv - Neuroscience 2023Quote: ... The DNA plasmids consisted of: Cre recombinase under the Chicken β-actin (CAG) promoter (#13775, Addgene), Cre-dependent stGtACR2-FusionRed under the hSyn1 promoter (#105677 ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 32 hours cells were transfected with an equimolar mix of CK2α/β plasmid (Addgene; #27093) and the relevant MCAM tail variant ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid vector pHSP70-Cas9 (donated by L. B. Voshall, Addgene #45945) (Gratz et al. ...
-
bioRxiv - Neuroscience 2022Quote: TALENs (AAVS1-TALEN-L and AAVS1-TALEN-R; Addgene, 59025/59026)(Gonzalez et al. ...
-
bioRxiv - Microbiology 2023Quote: ... -L and -G-expressing plasmids (Addgene, 64087, 64088, 64085 and 8454), using TransIT-LT1 transfection reagent ...
-
bioRxiv - Immunology 2019Quote: ... The reporter plasmid IFN-β-Luc (IFN-Beta_pGL3) was a gift from Nicolas Manel (Addgene plasmid # 102597) [59] ...
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lentiviral vector MSCV-β-catenin (ΔGSK-KT3)-IRES-GFP was a gift from Tannishtha Reya (Addgene #14717). The CRISPR/Cas9 plasmid pSpCas9n(BB)-2A-Puro was a gift from Feng Zhang (Addgene #48141) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR with pKD3 (pKD3 was a gift from Barry L. Wanner; Addgene plasmid #45604 ...
-
bioRxiv - Cancer Biology 2021Quote: ... BPN organoids were stably transduced with the β-catenin/TCF-dependent GFP reporter lentiviral construct 7TGP (Addgene plasmid #24305). Single cells were isolated from Matrigel using Cell Recovery Solution and TrypLE incubations ...
-
bioRxiv - Neuroscience 2021Quote: ... and inserted a strong CAG promoter (CMV immediate early enhancer/modified chicken β-actin promoter, from Addgene Plasmid #1378) in front of the FLEX-cassette to create pRMCE-CAG-Flex ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Genetics 2020Quote: ... Gibson assembly was used to clone the Vasa-β-globin-II fragment from the Vasa-Cre plasmid (Addgene; 15885) (Gallardo et al ...
-
bioRxiv - Genetics 2023Quote: ... 2μg of both TALEN-L and TALEN-R plasmids (Addgene, #59025 and #59026) and 4µg of pUCM-AAVS1-TO-hNGN2 plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... XbaI/NheI-digested biRhoBASTn cassettes were ligated into XbaI-digested and dephosphorylated eTC-GFP-β-actin-Zip (Addgene Plasmid #27123).
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Bioengineering 2021Quote: ... with 1000 ng of reporter and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Microbiology 2023Quote: ... such that gene could be inserted by Gibson Assembly into p15TV-L (Addgene #26093) linearized by BseRI digestion to produce the expression vector p15TVL-AcdA ...
-
bioRxiv - Immunology 2023Quote: ... whereas mCherry1-10-RNase L was inserted into pLenti-PGK-PuromycinR plasmid (Addgene: Plasmid #19070). The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1 ...
-
bioRxiv - Neuroscience 2019Quote: ... L cells were transiently transfected with Pi16-tGFP (Origne MG219996) and pm-Turq-ER (Addgene 36204) with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 1 μl of Adeno-Associated Virus (AAV) (AAV2/1.CMV.HI.eGFP-Cre.WPRE.SV40, titer >=8E+12 vg/mL, Addgene) mixed with 0.5 μl of fast green (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... Pichia pastoris expression vector pPICZc carrying human β-actin fused with thymosin β4 and 6xHis-tag was a gift from Mohan Balasubramanian (Addgene #111146, RRID:Addgene_111146). β-Actin cDNA was mutated to introduce K50C and C374A for labeling with a cross-linking reagent ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids used for mammalian one-hybrid experiments included segments of the β-catenin coding region cloned into pCMV-GAL4 vector (gifted by Liqun Luo (Addgene plasmid # 24345)) to create pGAL4-βCAT plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... eGFP knockin following the ORANGE method was performed (Willems et al., 2020): Neurons were transfected with vGLUT1-mCherry (Franck Polleux) and pOrange GFP-β-Actin KI (Addgene; Cat#131479) by CaCl2 on DIV 2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The construction of the two shRNA lentivirus vectors targeting the human β-catenin was performed following the Tet-pLKO Manual given by Addgene (plasmid#21915). The shRNA sequences used were the same as previously described (16) ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAVS1-TALEN-L and AAVS1-TALEN-R were gifts from Danwei Huangfu (Addgene plasmid # 59025 and 59026) (González et al. ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Cell Biology 2020Quote: ... of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572; http://n2t.net/addgene:26572; RRID:Addgene_26572). The mApple-myosin X was subcloned by the Protein Cloning and Expression Core facility of the MBI.
-
bioRxiv - Neuroscience 2021Quote: ... 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Microbiology 2019Quote: ... was a gift from L. Kane (de Souza, Oriss et al. 2005) and pLXSN-Axl (Addgene plasmid # 65222) a gift from A ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605; http://n2t.net/addgene:45605; RRID:Addgene_45605), (Datsenko & Wanner ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604; http://n2t.net/addgene:45604; RRID:Addgene_45604)) ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were microinjected 0.3 µl of AAV5-hsyn-NE2.1 (h-N01, WZ Biosciences) and 0.5 µl of AAV9-hsyn-jRGECO1a (100854, Addgene) to the left Cg1 (AP=2.2mm ...
-
bioRxiv - Developmental Biology 2021Quote: The Tg(fli1a:Brainbow1.0L)mu254 (flibow) transgenic fish was generated by cloning the CMV-Brainbow-1.0 L construct (Addgene #18721) downstream of the fli1a promoter62 ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...