Labshake search
Citations for Addgene :
51 - 100 of 108 citations for Toxoplasma gondii IgG antigen RH strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... early passage primary MEFs from all genotypes were infected in parallel with the SV40 large T antigen (Addgene:13970) (Zhao et al. ...
-
bioRxiv - Microbiology 2019Quote: ... cerevisiae ABC16-Monster strain using vectors p414 and p426 obtained from the Church lab (Addgene) as previously described72 ...
-
bioRxiv - Developmental Biology 2022Quote: E.coli strain BL21-DE3 was transformed with plasmid DNA pAG-MNase-6xHis (Addgene, plasmid #123461). Recombinant pAG-MNase was purified from cells grown in LB medium to OD600 0.6 at 37°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... strain PCC 7120 MurE WP_010995832.1 Q8YWF0|MURE_NOSS1) were inserted into the vector pPROEX HTa (Addgene) in order to be expressed in frame with an amino terminal ...
-
bioRxiv - Immunology 2022Quote: ... coli strain harboring a plasmid with the ilux operon (ilux pGEX(−)) was obtained from Addgene (plasmid # 107897 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Biophysics 2021Quote: ... and immortalized by transduction with a retrovirus expressing SV40 T antigen from pBABE-puro SV40LT (pBABE-puro SV40LT was a gift from Thomas Roberts (Addgene plasmid # 13970 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-GFP expressing ZT cells were obtained by sorting out non-fluorescence ZT cells and they were subsequently immortalized by transfecting them with SV40 T-antigen expressing plasmid (Addgene).
-
bioRxiv - Neuroscience 2021Quote: ... a second surgery was performed and 300 nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Cell Biology 2021Quote: ... coli strain was transformed with the pBAD::mRFP1 plasmid (Addgene plasmid #54667; Campbell et al., 2002) or the pZsGreen vector (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB921 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-Cterm-pFA6a-GFP/paGFP-F and Cut7-Cterm-pFA6a-GFP/paGFP-R ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB1147 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-988-Cterm-pFA6a-GFP-F (TTAAAGGGAACGACATCACTTGCTAATCATACTAATGAATTACTTGGTTTAG-GAGATGAACGGATCCCCGGGTTAATTAA ...
-
bioRxiv - Biochemistry 2023Quote: ... the strain was transformed with the TRP1-GAL1 cassette from pFA6-TRP1-PGAL1 (RRID:Addgene_41606, ref. (76)) ...
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Neuroscience 2021Quote: ... mice received 50 nL of helper AAV2/8 syn.dio.TVA.2A.GFP.2A.B19G (UNC vector core) followed 2 weeks later by 300nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Microbiology 2021Quote: ... tuberculosis Erdman strain was transformed with pMV306hsp+LuxG13 to generate an autoluminescent strain that was used for all experiments in this study (Addgene plasmid # 26161; http://n2t.net/addgene:26161; RRID:Addgene_26161) (105) ...
-
bioRxiv - Neuroscience 2021Quote: ... The transgenic strains expressing GCaMP6s under the actin promoter in neurons and in ectodermal epitheliomuscles (Addgene plasmid: #102558) were developed by microinjections of the embryos by Christophe Dupre in the Yuste lab (Columbia University)57 ...
-
bioRxiv - Microbiology 2022Quote: ... coli K-12 strain MG1655 that had been transformed with retron-TIR from Shigella dysenteriae NCTC2966 (Addgene #157883) or an empty vector control (pACYC184 ...
-
bioRxiv - Microbiology 2023Quote: ... The parental strains Mtb Erdman wild-type and espA-tn were electroporated with the plasmid pKM461 (Addgene, #108320) expressing tetracycline-inducible Che9c phage RecT annealase and Bxb1 phage integrase (80) ...
-
bioRxiv - Microbiology 2023Quote: Sequences of all 16 plasmids used for the generation of wild type SA11 strain were obtained from Addgene (https://www.addgene.org/Takeshi_Kobayashi/)5 ...
-
bioRxiv - Systems Biology 2023Quote: ... pNBU2_erm-TetR-P1T_DP-GH023 was a gift from Andrew Goodman used for creating the tetracyline-inducible recombinase strain (Addgene plasmid # 90324; http://n2t.net/addgene:90324; RRID:Addgene_90324). Briefly ...
-
bioRxiv - Microbiology 2023Quote: Constitutive reporter strains used in the following study were generated using the integrative vector pTdTomato-L5 (Addgene #140994). The chromosomal integration was done via the L5 phage site attB51 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding H2 IgG is available from Addgene; #190690 ...
-
bioRxiv - Molecular Biology 2023Quote: ... WT and T1150A catalytic domains tagged with nuclear localization sequence (NLS) of the SV40 Large T-antigen were cloned into the mVenus-C1 plasmid backbone (provided by Steven Vogel, Addgene plasmids no. 27794) (Koushik et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088; http://n2t.net/addgene:14088; RRID:Addgene_14088; a gift from William Hahn) as previously described (13) ...
-
bioRxiv - Microbiology 2022Quote: ... residues 336-528] yeast surface expression was established using Saccharomyces cerevisiae EBY100 strain and pJYDC1 plasmid (Addgene, Cat# 162458) as previously described22 ...
-
bioRxiv - Synthetic Biology 2022Quote: The RF10 (ΔlysA) and ML17 strains (ΔglnA) (a gift from Robert Gennis & Toshio Iwasaki Addgene plasmids 62076 and 61912) were transformed with the plasmids developed in this work and grown in LB to an OD600 of ∼0.3 ...
-
bioRxiv - Biochemistry 2019Quote: ... pyogenes Cas9 (SpCas9) were expressed in Escherichia coli strain BL21 (DE3) using the expression plasmid pMJ806 (Addgene plasmid # 39312) (Jinek et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli MG1655 strain bearing the mutagenesis machinery encoded in the pORTMAGE3 (Addgene Plasmid Number 72678, http://n2t.net/addgene:72678; RRID: Addgene_72678). In that case ...
-
bioRxiv - Synthetic Biology 2022Quote: The de novo sequencing and genome assembly of Syn61Δ3(ev5) (from a single-colony isolate of Addgene strain #174514) was performed by generating 84,136 Oxford Nanopore (ONT ...
-
bioRxiv - Systems Biology 2023Quote: ... pNBU2_erm-TetR-P1T_DP-GH023 was a gift from Andrew Goodman used for creating the tetracyline-inducible recombinase strain (Addgene plasmid # 90324 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The lacZ deficient (lac operon deletion) BL21-Gold-dLac (DE3) strain was a gift from Jeff Hasty (Addgene plasmid # 99247).9 The exception to this was the AtzB-enriched extract ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Microbiology 2021Quote: ... tuberculosis Erdman strain was transformed with pMV306hsp+LuxG13 to generate an autoluminescent strain that was used for all experiments in this study (Addgene plasmid # 26161 ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... eft-3::hpo-9 or BTBD9 alone were co-injected into tm3719 strain with pG2M36 (myo-3::dsRed) and pBCN27-R4R3 (rpl-28::PuroR, Addgene), which were used as the selective markers for transformation ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The LacZ deficient (lac operon deletion) BL21-Gold-dLac (DE3) strain was a gift from Jeff Hasty (Addgene plasmid # 99247).29
-
bioRxiv - Molecular Biology 2021Quote: ... coli Bl21 star (DE3) strain transformed with the plasmid pEVOL-pAzF (a gift from Prof. Peter Schultz, Addgene plasmid #31186) was used for protein expression ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana plants constitutively expressing Cas9 (Cas9 Benthe 193.22 T5 Homozygous; gratefully received from Dan Voytas) together with a strain containing pTRV1 (Addgene #148968) as previously described (Ellison et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... United States (Table S1) by using E. coli Syn61Δ3(ev5) (from the laboratory of Jason W. Chin (Addgene strain #174514)) as host ...
-
bioRxiv - Molecular Biology 2023Quote: For pseudotyping rVSV-ΔG*RenLuc with rabies spike protein the residues 1 - 485 including the ecto- and transmembrane domains but excluding the cytoplasmic tail of RABV-G (ERA strain, UniProtKB ID: P03524.1, residue numbering includes signal peptide) were cloned into pEBB vector (Addgene #22226), resulting in plasmid pEBB-R0CT ...
-
bioRxiv - Microbiology 2021Quote: Cas9 protein was produced in E.coli BL21 (DE3) strain after transformation with SP-Cas9 plasmid (a gift from Niels Geijsen, Addgene plasmid # 62731) and purified by metal chelate affinity chromatography on Ni-NTA agarose (Qiagen ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Repair templates were co-transformed into haploid ancestral strains with a plasmid encoding Cas9 and gRNAs targeting near the mutation site (Addgene #83476) (Laughery et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... we PCR amplified ~1kb homology arms from genomic DNA of the injection strain and cloned them into pHD-DsRed-attP (Addgene #51019). We co-injected guide RNAs and donor vectors (Rainbow Transgenics ...
-
bioRxiv - Biochemistry 2022Quote: ... smegmatis strains were generated with the ORBIT method (91). ORBIT requires transformation of the starting bacterial strain (M. smegmatis mc2155) with pKM444 (Addgene #108319), a plasmid that encodes a Che9c phage RecT annealase and a Bxb1 integrase ...
-
bioRxiv - Neuroscience 2020Quote: The UAS>B3RT-STOP-B3RT-Luciferase strain was created by replacement of the myr::RFP sequence in pJFRC160 (Addgene plasmid #32139)27 with firefly luciferase ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Pol3 depletion strain contains OsTIR1 integrated at the URA3 locus and POL3 tagged with IAA17(71-116)-9xmyc (Addgene #99522) as described in (57) ...
-
bioRxiv - Microbiology 2022Quote: ... 2015) or in a strain expressing Cas9 from the X1 locus under control of the vasa promoter (transgenesis plasmid: Addgene # 173670) and introgressed into the Ngousso genetic background ...
-
bioRxiv - Cell Biology 2023Quote: ... the strain expressing Hfl1-NG was produced from strain Y1508 by introducing a DNA fragment obtained by PCR using plasmid pFA6a-link-ymNeongreen-SpHis5 (Addgene, #125704) and oligonucleotides #1706 ...