Labshake search
Citations for Addgene :
1 - 50 of 2448 citations for T cell leukemia lymphoma protein 1B TCL1B Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and 1B vector (Addgene #29653), respectively and proteins were purified as previously described (Hambarde et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Biochemistry 2022Quote: ... The ShCas12k gene was inserted into the 1B (Addgene 29653) and 1R (Addgene 29664 ...
-
bioRxiv - Biochemistry 2021Quote: ... The ShCas12k gene was inserted into the 1B (Addgene 29653) and 1R (Addgene 29664 ...
-
bioRxiv - Biochemistry 2023Quote: ... The EcSduA gene was inserted into the 1B (Addgene: 29653) plasmid using ligation-independent cloning (LIC) ...
-
bioRxiv - Genetics 2023Quote: ... 1B in destination vector pENTRR4-ATCC-LacZ-GCTT (Addgene# 173668). The full annotated plasmid sequence is provided in Suppl ...
-
bioRxiv - Biophysics 2022Quote: ... The FnCas12a gene was inserted into the 1B plasmid (Addgene #29653) using ligation-independent cloning (LIC) ...
-
bioRxiv - Immunology 2020Quote: ... and a murine leukemia virus (MLV) Gag-Pol plasmid (Addgene # 14887) were purified using the Endo-Free Plasmid Maxi Kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... The ShTnsB gene and truncated derivatives were inserted by LIC into 1B (Addgene 29653) and 1C (Addgene 29659 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9-CAG-FLEX-EGFP (Suppl. Fig. 1B; Salk Vector Core; 1.4 x 1012; Addgene plasmid #51502); AAV1-hSyn-DIO-mRuby2-T2A-Synaptophysin-EGFP (Knowland ...
-
bioRxiv - Bioengineering 2024Quote: ... pET His6 TEV LIC cloning vector (1B) was a gift from Scott Gradia (Addgene plasmid # 29653). Recombinant DNA encoding for the transgenes was synthesized by Twist Bioscience HQ (South San Francisco ...
-
bioRxiv - Microbiology 2023Quote: Full length WT gp210 and mutant genes were cloned into UC Berkeley Macrolab vector 1B (Addgene #29653) to generate N-terminal fusions to a TEV protease-cleavable His6-tag ...
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Neuroscience 2020Quote: ... In this plasmid the DIO-GFP sequence was replaced by C1V1(t/t)-TS-mCherry from the rAAV CaMKIIa-C1V1(t/t)-TS-mCherry (Addgene, plasmid #35500).
-
bioRxiv - Immunology 2024Quote: ... HEK293 T cells were transfected with pCL-ECO (Addgene, cat # 12371) and the TRP2 vector with lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected with mTurquoise-Farnesyl-5 plasmid (#55551, Addgene) 24 hours prior to the assay ...
-
bioRxiv - Cell Biology 2024Quote: ... The T-REx293 cell line was transiently transfected with LentiCRISPRv2 (Addgene, #52961). The sgRNA sequences used for cloning LentiCRISPRv2-DHHC5 were ...
-
bioRxiv - Microbiology 2024Quote: ... the DNA sequences of Vibrio cholerae DdmD (Uniprot: Q9KR72) and DdmE (Uniprot: Q9KR73) were inserted into the 1B (Addgene: 29653) and 2HR-T (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... or 400nl of AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (≥1013 CG/ml, Addgene). Orexin promoter virus expression specificity has been characterized previously (González et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Cell Biology 2023Quote: ... TagRFP-T (Addgene #122200) or iRFP670 (Addgene # 122182 ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expression vector 1B (N-terminal 6x His (His6) tag followed by Tobacco etch virus (TEV) protease cleavage site) (Addgene plasmid: 29653).
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 was a gift from Christopher Harvey (Addgene viral prep # 124650-AAV9 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2G-T (Addgene plasmid #29707), 2GFP-T (Addgene plasmid #29716) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2GFP-T (Addgene plasmid #29716), and co-transformation vector 13S-A (Addgene plasmid 48323) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2HR-T (Addgene: 29718) plasmids using ligation-independent cloning (LIC) ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... was made by replacing the luciferase sequences with the fluorescent protein T-Sapphire in pHAGE NFKB-TA-LUC-UBC-dTomato-W (Addgene #49335). Additionally we replaced the marker tdTomato in Addgene #49335 with the resistance cassette for HygromycinB ...
-
bioRxiv - Biochemistry 2024Quote: ... or an N-terminal TEV protease-cleavable His6-maltose binding protein tag (UC Berkeley Macrolab vector 2C-T, Addgene ID 29706). Vectors were transformed into E ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... we transfected HEK293T cells with plasmid data from pRRLsin-SV40 T antigen-IRES-mCherry (Addgene #58993), packaging plasmid (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... EEA1 TagRFP-T (Addgene plasmid #42635), a gift from Silvia Corvera ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (titer: 2.3 × 1013 GC/ml; prepared by Addgene, MA, USA) into the unilateral dorsal hippocampus as described previously 87.
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO plasmids were co-transfected into HEK293-T cells along with packaging plasmids pMDLg/pRRE (Addgene #12251), pRSV-Rev (Addgene #12253 ...
-
bioRxiv - Immunology 2023Quote: Mouse naïve CD4+ T cells were transfected with C1-MPAct-mCherry (Addgene #155222, gift from Tobias Meyer) and C1-eGFP-CaaX (Addgene #86056 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with 500 ng of pSynSRE-T-Luc was a gift from Timothy Osborne (Addgene plasmid # 60444 ...
-
bioRxiv - Cell Biology 2024Quote: ... mesenchymal telocyte-depleted cells were infected with viral particles expressing the SV40 Large T antigen (Addgene #170255), two weeks after sorting ...
-
bioRxiv - Biochemistry 2021Quote: ... SV40 T antigen lentiviral plasmid (Addgene #22298) was packaged in HEK 293T cells using helper plasmids pMD2.G (Addgene #12259 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... hsp68lacZ (gift from T. Capellini, Addgene #37843). The light haplotype sequence file and hsp68lacZ vector were provided to Taconic Biosciences (NY ...
-
bioRxiv - Biochemistry 2021Quote: ... CRISPR Jurkat T cells were generated by stably expressing with lentiviral particles pLX-311-Cas9 construct (Addgene 96924) and transiently transfecting with Amaxa® Cell Line Nucleofector® Kit T (Ref ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...