Labshake search
Citations for Addgene :
101 - 150 of 165 citations for T 25 Flasks since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... was generated by replacing the CMV promoter in plasmid pscAAV-GFP (gift from John T Gray, Addgene, Cat#32396) with the CAG promoter derived from pAAV-CAG-GFP (gift from Edward Boyden ...
-
bioRxiv - Neuroscience 2019Quote: pAAV-CaMKIIa-ChR2(H134R)-EYFP and pAAV-CaMKIIa-hChR2(E123 T/T159C)-EYFP (Addgene, Watertown, USA #26969 and #35511) were gifts from Karl Deisseroth ...
-
bioRxiv - Biophysics 2021Quote: ... The pET MBP His6 LIC cloning vector (2Cc-T) was a gift from Scott Gradia (Addgene plasmid # 37237; http://n2t.net/addgene:37237; RRID: Addgene_37237).
-
bioRxiv - Cell Biology 2020Quote: ... RNP complex (Cas9 with tracrRNA for LMNB1 gene) (IDT) and 400 ng of LMNB1_mTagRFP-T HDR plasmid (Addgene 114403). Nucleofection was done with the pulses DN-100 ...
-
bioRxiv - Cell Biology 2022Quote: Constructs used were: Mito-DsRed2 (kindly provided by T. Schwarz, Harvard Medical School, Boston) and Mito-SBFP2 (Addgene #187964); untagged Parkin (Addgene #187897) ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 T-REx SNAPf-GLP-1R cells were co-transfected with an AP2-HA plasmid (μ2-HA-WT; Addgene plasmid # 32752 ...
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Microbiology 2020Quote: ... The CD4 expression vector pMX-CD4 and the TR expression vector pMD18-T TR were from Addgene (Watertown, MA) and Sino Biological Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... CdtB was cloned into the pET His6 TEV vector 2B-T (a gift from Scott Gradia, Addgene plasmid #29666) using sequence and ligation-independent cloning (SLIC ...
-
bioRxiv - Molecular Biology 2022Quote: ... early passage primary MEFs from all genotypes were infected in parallel with the SV40 large T antigen (Addgene:13970) (Zhao et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... and pET His6 TEV LIC cloning vector (2A-T, a generous gift from the Scott Gardia lab) (Addgene # 29665) using Ligation Independent Cloning to generate the pAKTB-α and pAKTB-β plasmids ...
-
bioRxiv - Neuroscience 2023Quote: Wild type Drosophila and human spectrins were cloned into a histidine tagged vector (2BC-T cloning vector, Addgene # 31070) using ligation independent cloning to obtain C-terminally tagged proteins ...
-
bioRxiv - Neuroscience 2020Quote: T A-QF2-SV40-3xP3-dsRed with QF2 and dsRed open reading frame from ppk301-T2A-QF2 (Addgene plasmid #130667) (Matthews et al. ...
-
bioRxiv - Biophysics 2021Quote: ... and immortalized by transduction with a retrovirus expressing SV40 T antigen from pBABE-puro SV40LT (pBABE-puro SV40LT was a gift from Thomas Roberts (Addgene plasmid # 13970 ...
-
bioRxiv - Neuroscience 2022Quote: ... CMV mScarlet-LC3B (subcloned from EGFP-LC3B, gift from T. Yoshimori, Osaka University, Japan, with mScarlet from Addgene plasmid #85054), CMV EGFP-PPM1H-WT (#DU62939 ...
-
bioRxiv - Biochemistry 2022Quote: Human SERPINE1 cDNA was subcloned from pAY-FE-PAI-1 using ligation independent cloning into the pET Flag TEV LIC cloning vector (2L-T, a gift from Scott Gradia—Addgene plasmid #29175 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... and pFA6a-link-yoTagRFP-T-Kan (Lee et al., 2013) was a gift from Wendell Lim & Kurt Thorn (Addgene 44906); both were given in the form of bacterial stabs ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-GFP expressing ZT cells were obtained by sorting out non-fluorescence ZT cells and they were subsequently immortalized by transfecting them with SV40 T-antigen expressing plasmid (Addgene).
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Cell Biology 2023Quote: Replication-deficient lentiviral particles were produced by CaCl2-transfection of 293-T cells with the packaging vector psPAX2 (Addgene, #12260), the envelope vector pMD2.G (Addgene ...
-
bioRxiv - Physiology 2020Quote: ... The murine Ntf3 cDNA was cloned into a Rosa26 locus targeting vector 25 purchased from Addgene (Cambridge, MA). Key features of the complete targeting construct as depicted in Suppl ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Immunology 2021Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vectors 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) or 2C-T (AmpR ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cancer Biology 2020Quote: Virus particles were generated in HEK 293-T cells after transfection with the above-mentioned plasmids in combination with the gag/pol plasmid psPAX2 (Addgene, 12260) and the VSV-g-envelope plasmid pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Physiology 2022Quote: ... 60% confluent monolayers of 293-T cells were transfected with LV shuttle vector pUltra-hot-LT and the packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: The plasmids for Dox-inducible expression of the ddGFP PAR-T constructs were generated using a cDNA for ddGFP-A (Addgene, 40286) or ddGFP-B (Addgene ...
-
bioRxiv - Biophysics 2022Quote: For biolayer interferometry experiments protease 2A from CV-B3 was sub-cloned into LIC cloning vector 2Bc-T (Addgene plasmid # 37236) with a C-terminal His6-tag ...
-
bioRxiv - Cell Biology 2022Quote: ... was made by replacing the luciferase sequences with the fluorescent protein T-Sapphire in pHAGE NFKB-TA-LUC-UBC-dTomato-W (Addgene #49335). Additionally we replaced the marker tdTomato in Addgene #49335 with the resistance cassette for HygromycinB ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Plant Biology 2020Quote: ... FolSIX418-242 and FolSIX617-225) and were introduced into either the pET His6 Sumo TEV LIC cloning vector (2S-T; Addgene #29711) or the modified ...
-
bioRxiv - Developmental Biology 2020Quote: ... The delCTCF(CS38) and inv(T-DOM) alleles were generated after cloning the gRNAs into the pX330:hSpCas9 (Addgene ID 42230) vector and DNA injection into pronuclei ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... N3 (residues 365-419) was similarly inserted into UC Berkeley Macrolab vector 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Biochemistry 2023Quote: ... The PrcA and PrcB genes were sub-cloned in the pET His6 TEV LIC cloning vector (2B-T, a generous gift from the Scott Gardia lab) (Addgene# 29666) and pET His6 TEV LIC cloning vector (2A-T ...
-
bioRxiv - Cell Biology 2023Quote: ... the nucleotide sequence of pEGFP-Mieap between the Nhe I and Xho I restriction sites containing EGFP was replaced with nucleotide sequence of pTagRFP-T-EEA1 (Addgene #42635) between the Nhe I and Xho I restriction sites containing TagRFP-T ...
-
bioRxiv - Neuroscience 2023Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5×1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... the mApple-Alpha-V-Integrin-25 was a gift from Michael Davidson (Addgene plasmid # 54866; http://n2t.net/addgene:54866; RRID: Addgene_54866), the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Biochemistry 2021Quote: ... and p53 TAD (13-61) were subcloned into the pET His6 GST TEV LIC cloning vector (2G-T) (a gift from Scott Gradia, Addgene plasmid #29707) and transformed into E ...
-
bioRxiv - Biochemistry 2021Quote: ... and p53 DBD (94-312) were subcloned into the pET His6 TEV LIC cloning vector (2B-T) (a gift from Scott Gradia, Addgene plasmid #29666) and transformed into E ...
-
bioRxiv - Cell Biology 2021Quote: ... pLBR08 was generated via Gibson assembly of PCR-amplified LAMP1 cDNA (from mTagRFP-T-Lysosomes-20 acquired from Nikon Imaging Center at UCSF, Addgene plasmid #58022) and PCR-amplified XTEN80-mEGFP-3xHA immunoprecipitation tag with a linearized backbone generated from ClaI and BspDI (New England BioLabs cat ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding a fragment of human Archease (Uniprot Q8IWT0) spanning residues 27−167 was cloned into the UC Berkeley MacroLab 2M-T vector (gift from Scott Gradia, Addgene plasmid #29708) to express a fusion protein containing an N-terminal His6 tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... The obtained pGEM-T-RBM8A plasmid was cleaved with Sfi I and subcloned into the Sfi I site of pSBtet-GP vector (Addgene, Watertown, MA, USA) [25].
-
bioRxiv - Molecular Biology 2023Quote: ... WT and T1150A catalytic domains tagged with nuclear localization sequence (NLS) of the SV40 Large T-antigen were cloned into the mVenus-C1 plasmid backbone (provided by Steven Vogel, Addgene plasmids no. 27794) (Koushik et al. ...