Labshake search
Citations for Addgene :
1 - 50 of 795 citations for Synthetic Apoptosis Regulator Bcl 2 BCL2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... gRNAs targeting BCL2 or BCL-W were cloned in pLentiGuide (Addgene #117986) that was linearized with BsmBI (NEB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Cell Biology 2022Quote: ... tat (transcriptional regulator) and rev (post-transcriptional regulator) and the envelope plasmid psPAX2 encoding VSV-G coat protein were purchased from Addgene repository ...
-
bioRxiv - Cell Biology 2021Quote: Nos regulator elements drive the myosin II RLC (Eric Wieschaus56, Addgene 20163) fused to tdTomato (Michael Davidson ...
-
bioRxiv - Cancer Biology 2022Quote: Retroviral particles from pMIG Bcl-xL (Addgene #8790), and lentiviral particles from pLenti6.3/TO/V5 containing IDH1R132H,13 or pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cancer Biology 2020Quote: ... List of plasmids used in this work: pCDH-puro-Bcl2 (Cheng et al., Addgene plasmid #46971), Tet-pLKO-puro (Wiederschain et al. ...
-
bioRxiv - Cancer Biology 2020Quote: Bcl-xS and RBM10 were obtained from Addgene (Cambridge, MA). Plasmid transfections required 3 μg/well and were carried out using 0.1% Fugene HD (Promega).
-
bioRxiv - Genomics 2023Quote: ... the entry vector was constructed by adding a bcl-2 splice acceptor and four SV40 polyA-signals to a plasmid backbone based on pSMART (Addgene #49157) containing a green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Synthetic gRNA oligonucleotides were cloned into pLentiCRISPRv2 (Addgene #52961) at BsmBI (# R0580S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Immunology 2021Quote: Bcl2 overexpression vector was generated by cloning Bcl2 cDNA (Transomic Technologies, Cat. TCM1304) into the pMSCV-loxp-dsRed-loxP-eGFP-puro-WPRE vector (Addgene #32702) using the EcoRI and NsiI restriction sites ...
-
bioRxiv - Genomics 2022Quote: sgRNA-CRISPR library targeting 550 chromatin regulators (Suppl Table 1) was ordered from IDT Technologies and cloned using Gibson assembly in CRISP-seq backbone (Addgene #85707). The Gibson assembly product was electroporated in Endura ElectroCompetent cells following the manufacturer’s protocol (Endura #60242-2 ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... which expresses Cas9 and a synthetic single-guide RNA (Addgene), as follows ...
-
bioRxiv - Cell Biology 2021Quote: ΦNX-ecotropic packaging cells were transfected with pBABE-hygro (Addgene plasmid # 1765; empty or Bcl-XL) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The annealed synthetic sgRNA oligonucleotides were cloned into pLentiCRISPRv2 vector (Addgene #52961) at BsmBI restriction sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and a synthetic intron was PCR-amplified from pDEST-APLO (Addgene 112805) (77) ...
-
bioRxiv - Neuroscience 2023Quote: ... The synthetic gene was cloned into a pExp-DsbC expression vector (Addgene #129243) containing an N-terminal His 8-tag fused to a DsbC solubility enhancing tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... CPxx synthetic promoters and RBS were either amplified from plasmids acquired from Addgene, from our stocks ...
-
bioRxiv - Microbiology 2022Quote: ... Synthetic oligonucleotides were designed as described (33) and cloned into the PX459 vector (Addgene). Two hundred ng of the resulting plasmid was transfected into 1.0 × 105 Neuro-2a cells in a 24-well plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... YAP/TAZ-responsive synthetic promoter (8xGTIIC-luciferase) was a gift from Stefano Piccolo (Addgene plasmid # 34615 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... synthetic gene fragments from Integrated DNA Technologies (IDT) and the EcoFlex kit (47) from Addgene.
-
bioRxiv - Synthetic Biology 2020Quote: ... A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #:1000000061). Characterization plasmids consisted of 8 parts ...
-
bioRxiv - Genetics 2021Quote: ... Synthetic Cas9 mRNA was transcribed from pCS2-nCas9n (gift of Dr. Wenbiao Chen, Addgene plasmid # 47929). The injection cocktail contained 200 ng/ul Chr12 sgRNA ...
-
bioRxiv - Bioengineering 2023Quote: A synthetic toolkit (MoClo-YTK) containing yeast parts were gifts from the Dueber Lab (Addgene #1000000061). Expression vectors for yeGFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... The synthetic Cas9 mRNA was transcribed from the XbaI linearized pT3TS-nls-zCas9-nls vector (Addgene #46757)(74 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthetic cell type specific promoters were obtained from the following Addgene plasmids: 161_pAAV-ProD5-CatCh-GFP-WPRE (Addgene plasmid # 125981 ...
-
bioRxiv - Cancer Biology 2022Quote: ... YAP/TAZ-responsive synthetic promoter (8xGTIIC-luciferase) was a gift from Stefano Piccolo (Addgene plasmid # 34615; http://n2t.net/addgene:34615 ; RRID:Addgene_34615). pCDNA3-V5-PTPN14-wild type was a gift from Jianmin Zhang (Addgene plasmid # 61003 ...
-
bioRxiv - Cell Biology 2023Quote: ... pAS139 was used in a multi-site Gateway LR reaction together with entry plasmids pCG142 (pie-1 intron:pie-1 promoter in PDONRP4P1R) and pCM1.53 (GFP with worm codon bias and synthetic introns in pDONR201) (Addgene plasmids # 17246 and # 17250 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The synthetic sequence was assembled into the AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR vector (Addgene)44 into the MluI and KpnI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... The codon-optimized mCherry sequence with synthetic introns and a C-terminal linker was amplified from pJJR83 (Addgene #75028). Correct amplification and assembly was confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Bioengineering 2020Quote: The pEERM1-PATS vector was created by inserting the synthetic patchoulol synthase gene into the pEERM1 plasmid (Addgene plasmid #64024)4 using HiFi assembly ...
-
bioRxiv - Bioengineering 2020Quote: Synthetic thermal switches were produced as gene blocks by IDT and cloned into the Lego-C backbone (Addgene plasmid #27348). The core promoters were truncated immediately upstream of their previously described TATA boxes at their 5’-termini and at their translational start site on their 3’-termini 76-78 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... separated by a P2A self-cleaving peptide (Addgene ID NK676).
-
bioRxiv - Molecular Biology 2024Quote: ... # 48076) and a transit peptide (in plasmid pICH78133; Addgene # 50292) to target the biosensor to the nuclei and chloroplast stroma respectively ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding human DAT (synthetic gene kindly provided by Dr. Jonathan Javitch, Columbia University, NY, USA61 was inserted into pmEOS2-C1 (RRID: Addgene#54510) to generate pmEOS2-hDAT C1 encoding hDAT with mEOS2 fused to the N-terminus ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linear donor was generated by PCR and gel purified from a plasmid harboring a synthetic AID-P2A-Hygromycin insert (pMGS54, Addgene #126583). We amplified the insertion using primers that contain 50 nucleotide homology tails ...
-
bioRxiv - Microbiology 2022Quote: CRISPR-Cas9 counterselection plasmids (pSelect) were constructed by cloning synthetic spacer sequences into the previously established pCas9 backbone (Addgene no.42876). Under guidance of designated crRNAs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Plant Biology 2023Quote: ... L0 parts were synthesised either by GENEWIZ or Twist Bioscience following the standard syntax for plant synthetic biology with PROM5 or PROM and 5UTR overhangs and cloned into the plasmid pUAP1 (Addgene #63674) (Patron et al. ...
-
bioRxiv - Immunology 2023Quote: ... expressing the firefly coding sequence under control of a synthetic promoter containing SMAD-binding elements (SBEs) was obtained from AddGene (#45126). pEFBOS mCherry-mSTING expressing monomeric Cherry fused to the N-terminus of murine STING ...
-
bioRxiv - Biochemistry 2023Quote: The sequence coding for human GLP1R was ordered as a synthetic DNA geneblock (Integrated DNA Technologies) bearing HindIII and NotI restriction site for cloning into a CMV-promoter plasmid (Addgene #60360). Sequences coding for the hemagglutinin secretion motif and a FLAG Tag were added to the N-terminus of the GLP1R open reading frame to increase plasma membrane expression and enable receptor labelling ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Cancer Biology 2023Quote: Inducible Myc constructs were created from synthetic fragments (Twist Biosciences) sub-cloned into a general backbone derived from LT3GEPIR (gift from J. Zuber; Addgene plasmid #111177) using Gibson Assembly reagents (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... WNK1 fragments were generated by PCR or as synthetic gBlocks and were ligated via restriction cloning to the XmaI site of linearized Cry2PHR or Cry2Olig (E490G) vectors (Addgene #26866 and #60032), positioned in-frame between the PHR domain and mCherry.