Labshake search
Citations for Addgene :
1 - 50 of 58 citations for Streptococcus Pneumoniae Antigen Native Extract since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae ATCC 10031 was used for the OMVs purification. K. pneumoniae was transformed using the calcium chloride method with pGR (K. pneumoniae-pGR) (Addgene, Massachusetts, USA) and PRM-GFP (K ...
-
bioRxiv - Microbiology 2021Quote: ... and PRM-GFP (K. pneumoniae-PRM) (Addgene, Massachusetts, USA) respectively [40,41] ...
-
bioRxiv - Microbiology 2020Quote: ... the Streptococcus pyogenes tracrRNA-encoding sequence from pCas9 (Addgene #42876) was amplified with BKMP45-46 and introduced into pDonorP1-P5 (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: Plasmid pMJ806 containing Streptococcus pyogenes Cas9 was obtained from Addgene (Cambridge, MA). Plasmid pHypaCas9 was a gift from Dr ...
-
bioRxiv - Molecular Biology 2019Quote: Streptococcus pyogenes Cas9 and gRNAs were expressed from the pX330 plasmid (Addgene #42230) (Cong et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of SpCas9n (Streptococcus pyogenes Cas9) was obtained from pX335 (Addgene #42335) and subcloned into a AAV backbone under the MeCP2 promoter as in [45] ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the Streptococcus Pyogenes dCas9GCN4 was PCR amplified from the PlatTET-gRNA2 plasmid 37 (Addgene #82559), and sub-cloned under the control of a DOX-inducible TRE-3G promoter into a PiggyBac backbone ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast expression constructs for nuclease-inactivated Cas9 (D10A/H840A mutations) from Streptococcus pyogenes –dCas9 (Addgene #46920) (Gilbert et al 2013 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9 (hSpCas929,50; a gift from Peter Duchek (Addgene plasmid #59985 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cambridge, MA). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1 ...
-
bioRxiv - Cancer Biology 2020Quote: Single knockouts were generated either using a two-vector Streptococcus pyogenes (Sp) Cas9 system: LentiV_SpCas9_puro (Addgene, 108100) and LRG2.1 backbone (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9 (hSpCas929,50; a gift from Peter Duchek (Addgene plasmid #59985; http://n2t.net/addgene:59985; RRID:Addgene_59985). All oligos and gBlocks Gene Fragments were purchased from IDT (see Supplementary Table 1 for all oligo and gBlock sequences) ...
-
bioRxiv - Microbiology 2023Quote: HeLa S3 cells were transduced with a Streptococcus pyogenes (sp)Cas9 expressing lentivirus (#52962; Addgene, Watertown, MA) at an MOI of 20 transduction units (TU)/cell ...
-
bioRxiv - Cancer Biology 2020Quote: ... the optimized sgRNA lentiviral expression vector (LRG2.1T) and the lentiviral human codon-optimized Streptococcus pyogenes Cas9 vector (LentiV_Cas9_Puro, Addgene: 108100) were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cat. No. 44719). Two chimeric guide RNA expression cassettes containing two of the following sgRNAs (sgRNA1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SV40T antigen (Addgene Plasmid #21826) were obtained from Addgene.
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid: #59985; http://n2t.net/addgene: 59985; RRID: Addgene_59985). For expression in mosquito cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the sequence of a human codon optimized Streptococcus pyogenes Cas9 (SpCas9) obtained from pX330-U6-Chimeric_BB-CBh-SpCas9 from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type Streptococcus pyogenes Cas9 REC3 domain (506-712) possessing an amino-terminal His10-MBP tag (Addgene, no. 101205) followed by a TEV protease site was expressed in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Biochemistry 2021Quote: ... SV40 T antigen lentiviral plasmid (Addgene #22298) was packaged in HEK 293T cells using helper plasmids pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2020Quote: ... Her2 antigen was acquired from Addgene (pCDNA3). CD99 (GenBank ...
-
bioRxiv - Genetics 2021Quote: ... For the pPB_TRE3G::dCas9-5XGCN4_EF1a::TetOn-Hygro, the Streptococcus pyogenes dCas9GCN4 was PCR amplified from the PlatTET-gRNA2 plasmid (Morita et al., 2016) (Addgene #82559), and cloned together with a d2 destabilization domain under control of the TRE3G promoter in a PiggyBac backbone vector also containing the TET-ON3G transactivator and the Hygromycin resistance gene separated by an IRES sequence and under control of the CAG promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Large T SV40 antigen (Addgene plasmid # 21826) as described ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Immunology 2020Quote: ... A549 cells were first made to stably express Streptococcus pyogenes Cas9 following blasticidin selection of cells transduced with lentiCas9-Blast (gift from Feng Zhang, Addgene plasmid # 52962 (19)) ...
-
bioRxiv - Microbiology 2019Quote: ... The native dcas9 and transcriptional terminators were PCR amplified from pdCas9-bacteria (Addgene plasmid # 44249) with Q5 polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... The antigen-binding fragments (Fab) were cloned into pHLSec vector (Addgene, #99845) using AgeI and XhoI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... The SV40 Large T antigen and HA-TRIM71 were purchased from Addgene (plasmid # 136616 and #52717 ...
-
bioRxiv - Immunology 2024Quote: ... MEFs were transfected with SV40 small+large T antigen-expressing plasmid (22298, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2020Quote: ... SV40 Large T antigen CDS was subcloned from pBABE-puro-SV40 LgT plasmid (Addgene 13970) into LeGO iG vector between BamHI and EcoRI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... MEFs were then expanded to 6-well plates and transiently transfected with SV40T antigen (Addgene) and maintained until stably proliferative ...
-
bioRxiv - Biochemistry 2022Quote: Plasmids encoding the full-length spike proteins with native signal peptides were cloned into the background of the HDM-SARS2-Spike-delta21 plasmid (Addgene Plasmid #155130). This construct contains a 21 amino acid c-terminal deletion to promote viral expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336, #149334, #149333) (Pleiner et al. ...
-
bioRxiv - Immunology 2022Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Biochemistry 2023Quote: The 21-amino acid C-terminally truncated spike proteins with native signal peptides were cloned in place of the HDM-SARS2-spike-delta21 gene (Addgene plasmid, 155130). This construct contains a 21-amino acid C-terminal deletion to promote viral production ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Genomics 2021Quote: ... Early passage primary MEFs were transformed with SV-40 T antigen containing plasmid pBSSVD2005 (ADDGENE, Cambridge, MA) to generate immortalized MEFs ...
-
bioRxiv - Microbiology 2019Quote: ... They were immortalized by transduction with a retroviral vector encoding SV40 large T antigen (pBABE-zeo largeTcDNA, Addgene). The Atf6+/+ vs ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary MEFs were then immortalized by transient transfection with a plasmid expressing SV40 large T antigen (Addgene #21826). Single cell clones were then isolated by limiting dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088 ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... and SV40-T/t antigens expressing lentiviruses using vectors pLenti CMV-RasV12-Neo (w108-1) (HRAS G12V, #22259, Addgene), and pLenti-CMV/TO-SV40 small + Large T (w612-1 ...
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Molecular Biology 2022Quote: ... early passage primary MEFs from all genotypes were infected in parallel with the SV40 large T antigen (Addgene:13970) (Zhao et al. ...
-
bioRxiv - Biophysics 2021Quote: ... and immortalized by transduction with a retrovirus expressing SV40 T antigen from pBABE-puro SV40LT (pBABE-puro SV40LT was a gift from Thomas Roberts (Addgene plasmid # 13970 ...