Labshake search
Citations for Addgene :
251 - 300 of 646 citations for Steroid Receptor Co Factor Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2019Quote: ... These were then co-transfected with an hCas9 plasmid (gift from George Church, Addgene plasmid #41815). gRNA sequences can be found in Supplementary Table 2 ...
-
bioRxiv - Genomics 2020Quote: ... shRNA expression vectors were co-transfected with the pCMV- R8.74 and pMD2.G expression plasmids (Addgene #22036 and #12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... were co-transfected with VSV-G and psPAX2 (a gift from Didier Trono, Addgene plasmid #12260) plasmids into the HEK293T packaging cell line ...
-
bioRxiv - Biochemistry 2021Quote: ... or pHAGE plasmids for overexpression were co-transfected with packaging vectors (psPAX2 and pMD2.G, Addgene) into 293T cells using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: HEK-293T cells were co-transfected with the pcw107-V5 plasmid expressing CA-STAT3 (Addgene #64611), VSV-G envelope plasmid ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles were produced in HEK293T cells by co-transfecting packaging vector psPAX2 (8µg, Addgene, #12260), envelop vector pMD2.G (4µg ...
-
bioRxiv - Molecular Biology 2022Quote: ... with cloned gRNAs were co-transfected (as described above) with lentiviral packaging plasmid psPAX2 (Addgene #12260) and envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Genomics 2021Quote: TKOv3 library lentivirus was produced by co-transfection of lentiviral vectors psPAX2 (packaging vector, Addgene #12260) and pMD2.G (envelope vector ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: ... by Gibson assembly and co-transfected it along with the pXAT2 vector (Addgene cat. no. 80494) into NCRM1 cells ...
-
bioRxiv - Biophysics 2021Quote: ... BL21 AI cell was co-transformed with MutS-bio and BirA expression plasmid (Addgene plasmid #20857)70 and was grown in LB containing 50 μg/ml kanamycin ...
-
bioRxiv - Biophysics 2020Quote: ... HEK293T cells on the wells were co-transfected with 1250 ng of ACE2 (Addgene plasmid #141185) and 1250 ng of TMPRSS2 expression plasmids (Addgene plasmid #145843 ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNA plasmid library was packaged in 293FT cells after co-transfection with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Genomics 2021Quote: ... CRISPR plasmids were co-transfected in 60 % confluent HEK293T with packaging vectors pMD2.G (Addgene #12259), psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviral particles were generated by co-transfecting HEK293T cells with 3.25 μg pCMVR8.2 (Addgene #12263) and 1.7 μg pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Cell Biology 2022Quote: ... H1 hESCs were then co-transfected with sgAAVS1-pX458 and a GCaMP6f donor vector (Addgene #73503) containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells were co-transfected with equal amounts of the pspgRNA plasmids and pCas9_GFP (Addgene plasmid #44719 ...
-
bioRxiv - Immunology 2023Quote: ... was co-transfected with packaging plasmids pCAG-VSVG and psPAX2 (Addgene plasmids 35616 and 12260, respectively). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... The lentiviruses were also produced in HEK 293T cells by co-transfecting pLKO.1puro (Addgene #8453), psPAX2 (Addgene #12260) ...
-
bioRxiv - Genomics 2023Quote: ... Digested plasmid to co-express a gRNA and Cas9 with a puromycin resistance cassette (pX459; Addgene) was purified from a 1% agarose gel using a Gel and PCR Clean-up Kit (Macherey-Nagel ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987). After 24 h the cells were selected with puromycin and expanded ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transformants were obtained by co-injecting this plasmid with a pCFD3-dU6:3gRNA plasmid (Addgene #49410) expressing the gRNA GACGCATTTATGGATGCGGG and screening for 3xPax3dsRED ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were co-transfected using polyethylenimine (PEI) with Cas9 (pU6-CBh-Cas9-T2A-BFP: Addgene 64323) and gRNA-Puro (pKLV2.2-h7SKgRNA-hU6gRNA-PGKpuroBFP ...
-
bioRxiv - Genomics 2023Quote: ... HEK293T cells were co-transfected with two packaging plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and either a desired transfer plasmid ...
-
bioRxiv - Immunology 2023Quote: ... The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2, Addgene) into HEK293T cells to produce lentiviruses ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T were co-transfected with lentiviral shRNA constructs and the packaging plasmids psPAX2 (Addgene; Cat# 12260) and MD2.G (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... cells were co-transfected with 0.5 μg of pCMV(CAT)T7-SB100 (transposase vector; Addgene, 34879) and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...
-
bioRxiv - Developmental Biology 2024Quote: The KO cell lines were generated by co-transfecting pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) with two sgRNAs (sequences see table below) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were co-transfected with a construct of interest and packaging plasmids Gag-Pol 8.91 (Addgene #187441) and VSV-G (Addgene #8454 ...
-
bioRxiv - Microbiology 2023Quote: Lentiviruses were generated by co-transfection of vector constructs and second-generation packaging plasmids (psPAX2, Addgene no ...
-
bioRxiv - Biophysics 2024Quote: ... Lentiviral vectors were co-transfected with the lentiviral packaging plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMV-dR8.2 (Addgene plasmid #8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral plasmids containing the relevant guides were co-transfected with helper plasmids psPAX2 (Addgene Ref. 12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene, MA, USA, #12263) and pCMV-VsVg (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... The lentivirus were generated by co-transfecting the dCas9-KRAB plasmid (gifts from Kristen Brennand; Addgene, #99372) with the three 3rd generation packaging vectors pMDLg/pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral vectors were prepared by co-transfection of vector plasmids with packaging plasmid pCMVR8.74 (Addgene plasmid #22036) and the ecotropic envelope expression plasmid ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Neuroscience 2019Quote: ... Lentivirus was packaged via co-transfection of each pGIPZ-shRNA with pCMV-VSV-G (Addgene plasmid #8454)[29] and pCMV-dR8.2 (Addgene plasmid #8455)[29] into HEK 293T cells using Lipofectamine 3000 reagent (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO plasmids were co-transfected into HEK293-T cells along with packaging plasmids pMDLg/pRRE (Addgene #12251), pRSV-Rev (Addgene #12253 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2014) was co-transfected into 293FT cells with the lentiviral packaging plasmids psPAX2 and pMD2.G (Addgene). Viral production was accomplished as described previously (Joung et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 70-80% confluency were co-transfected with the lentiviral plasmid and lentiviral helper plasmids (psPAX2: Addgene #12260 and pMD2.G ...
-
bioRxiv - Cancer Biology 2022Quote: ... the transfer plasmid was co-transfected into HEK-293T cells with the packaging plasmids pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Immunology 2020Quote: ... hACE2 (NM_001371415) was cloned into the pBOB vector and co-transfected with lentiviral vectors pMDL (Addgene #12251), pREV (Addgene #12253) ...
-
bioRxiv - Genetics 2020Quote: ... we co-transfected pcDNA3.1-SARS2-Spike or pcDNA3.1-SARS2-SpikeD614G (see above) with pcDNA3.1-ACE2 (Addgene 1786) at a 1:1 ratio (Spike ...