Labshake search
Citations for Addgene :
151 - 200 of 210 citations for Somatotropin GH Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Immunology 2022Quote: ... SpCas9-expressing Nrp1-/- NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... heterozygous Adora2a-Cre mouse neonates were injected bilaterally with the Cre-recombinase-dependent viral vectors AAV5-hSyn- DIO-hM4D-mCherry virus (Addgene Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of mouse ARNTL was synthesized (Twist Biosciences) and cloned into the NheI site of FUW-TetO-MCS (Addgene plasmid #84008 ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Cancer Biology 2021Quote: We generated pX330 Mettl3 vector by cloning the previously described sgRNA targeting mouse Mettl316 into the pX330 plasmid (Addgene Plasmid #42230). The pX330 plasmid was digested using BbsI and a pair of partially complementary annealed oligos containing overhangs from BbsI site and Mettl3 sgRNA sequence were cloned scarlessly into the vector ...
-
bioRxiv - Cell Biology 2020Quote: For derivation of HA-Smo and Smo-HA ESCs mouse Smo was amplified by PCR from the pGEN-mSmo (Addgene, #37673) and introduced in the PB-HA-IRES-Neo vector ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... Reprogramming was carried out by transducing MEFs with a doxycycline-inducible mouse OKSM (pHAGE2-tetO-STEMCCA)(Sommer et al., 2009) and rtTA (FUdeltaGW-rtTA, Addgene 19780)(Maherali et al. ...
-
bioRxiv - Biophysics 2021Quote: ... HeLa cells were stably engineered to display a doxycycline-inducible GFP fused to a mouse CD80 transmembrane domain using standard second-generation lentivector production protocols and the plasmids pMD2G (Addgene 12259), pCMVR8.74 (Addgene 22036) ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Cell Biology 2021Quote: ... The expression vector for N-terminally FLAG-tagged mouse SYDE2 was generated by PCR amplification of the coding sequence from pNICE HA-mSYD1B (Addgene #59362) and insertion into pcDNA3-FLAG by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Cell Biology 2022Quote: The S1R-Apex construct was generated by cloning a gene synthesized product containing the cDNA sequence for mouse S1R into the pCDNA3_Sec61B-V5-APEX2 vector (Addgene plasmid 83411) (67) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904 ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Developmental Biology 2020Quote: ... Constitutive active form of mouse ChREBP was subcloned into pMSCVhyg-3xT7 to generate pMSCVhyg-3xT7-CA-ChREBP using full length clone as templates (Addgene #39235). All plasmids were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form the Mouse Brie CRISPR knockout pooled library (a gift from David Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Supplementary Figure 1A) ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression construct for mouse MLXIPL was generated by PCR-amplification from a template plasmid (from the laboratory of Isabelle Leclerc, Addgene #39235) and cloned into pcDNA3 with an N-terminal FLAG epitope tag by Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...
-
bioRxiv - Developmental Biology 2022Quote: ... guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief ...
-
bioRxiv - Microbiology 2022Quote: The mouse Brie pooled sgRNA library on the lentiGuide-Puro backbone was obtained from David Root and John Doench (Addgene #73633) (23) ...
-
bioRxiv - Evolutionary Biology 2023Quote: Full-length human GLI3 and mouse Gli3 cDNAs were obtained from pEGFPC3-hGli3 (a gift from Aimin Liu, Addgene plasmid, (57)) and pCMV-Gli3-Myc-DDK (ORIGENE ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...
-
bioRxiv - Genetics 2023Quote: The gRNA library used for the screening was the Mouse Improved Genome-wide Knockout CRISPR Library v2 (a gift from Kosuke Yusa, Addgene, #67988) (48) ...
-
bioRxiv - Developmental Biology 2023Quote: Single guide RNAs (sgRNAs) targeting each of the specific target genes were retrieved from the Mouse CRISPR Knockout Pooled Library (Addgene #73632). Two sgRNA sequences were selected per gene of interest (for sgRNAs sequences ...
-
bioRxiv - Developmental Biology 2023Quote: ... of Fbxo24 and Skp1 were cloned and amplified using cDNA obtained from mouse testis and inserted into the multiple cloning site of pCAG1.1 vector (Addgene; Plasmid #173685). To generate the expression vector coding Fbxo24(ΔF-box) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 12ug of each pTwist Lenti Puro SFFV WPRE lentiviral construct encoding either human or mouse PRLR were co-transfected with 9ug of psPAX2 (Addgene; 12260) and 3ug of pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2020Quote: ... we amplified the open reading frame from a mouse cDNA library using polymerase chain reaction and inserted it into a pBAD His6 Sumo TEV LIC cloning vector (Addgene Plasmid #37507) that had been engineered to encode an N-terminal Avi tag and C-terminal ybbR tag58 ...
-
bioRxiv - Developmental Biology 2021Quote: ... then the coding sequence for mouse KAT2A was amplified from the vector pCMV-sport2-mGCN5 (gift from Sharon Dent, Addgene plasmid # 23098), and cloned into the backbone vector between SpeI and AvrII sites ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... sgRNA validation sgRNAs cut efficiency was assessed in Mouse Embryonic Fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin-resistance (Addgene plasmid #52962). 48 hours upon infection ...
-
bioRxiv - Neuroscience 2022Quote: ... ACGCTTCAATGCTCTCTCGC targeting the second exon of mouse piezo1 as reference (Del Marmol, Touhara et al. 2018) was inserted into MLM3636 vector (Addgene Plasmid #43860). SgRNA inserted MLM3636 and Cas9 expression plasmid pX459 v2.0 (Addgene Plasmid #62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Physiology 2023Quote: ... The latter consisted of the pLV6 backbone and a mouse per2 promoter with adjacent luciferase sequence contained in the pGL3 basic E2 vector (Addgene plasmid 48747). To ligate the Per2:luciferase reporter with pLV6 backbone we designed a restriction cloning approach shown to be efficient in large plasmids using the QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373; http://n2t.net/addgene:127373; RRID: Addgene_127373; kind gift by Lance Miller) to generate pR26-CMV-Opa1 (pAH33) ...