Labshake search
Citations for Addgene :
1 - 50 of 471 citations for Small ribosomal subunit protein uS12 RPS23 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biophysics 2024Quote: ... and γ subunits were gifts from Christie Thomas (Addgene plasmid # 83430 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928, http://n2t.net/addgene:17928; RRID:Addgene_17928; (Luo et al., 2002)) ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925; http://n2t.net/addgene:17925; RRID:Addgene_17925; (Luo et al., 2002)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... or small splice variant TNC (Addgene 65415) and WPMY cells were overexpressed with Wnt-2 (Addgene 43809) ...
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the epsilon subunit of the bacterial FoF1-ATP synthase cDNA (Addgene plasmid #113906) was inserted into mTQ2-pRSET-A plasmid at Tyr-145 (between the KpnI and EcoRI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene #53755-53762). Each was subcloned into FlexiBAC SF9 expression plasmids61 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Microbiology 2020Quote: ACE2 small guide RNA was constructed into pSLQ1651 (Addgene #51024) (44 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Biochemistry 2021Quote: URA7 and URA8 wild type genes with ribosomal binding site were cloned into pet28b-6His (Addgene, Massachusetts ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 65]: CFP was inserted into the TM3-TM4 intracellular loop of the β2 subunit (Addgene, catalog #: 15106), YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pLenti-CMV/TO-SV40 small + Large T (w612-1) (#22298, Addgene), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Neuroscience 2020Quote: ... receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168; http://n2t.net/addgene:49168; RRID: Addgene_49168). Rat GABAAα1 (NM_183326 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Immunology 2024Quote: ... MEFs were transfected with SV40 small+large T antigen-expressing plasmid (22298, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were immortalised using the catalytic subunit of hTERT delivered by transduction using a lentivirus vector (pLV-hTERT-IRES-Hygro; Addgene). Two days post-transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... A small cohort of mice also received pAAV9-hSyn-DIO-hM4D(Gi)-mCherry (RRID:Addgene_44362 ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Genomics 2024Quote: ... a variant of which containing a ribosomal binding site and mRFP in place of a gene fragment has been deposited to Addgene (Addgene #209325). A slight modification to this plasmid was made to include SapI type II restriction sites ...
-
bioRxiv - Genetics 2021Quote: ... is intended for small-medium sized donor DNAs (<15kb) while the p5155 (Addgene reference 175391) is a low-copy version for use with larger donor DNAs (>15kb) ...
-
bioRxiv - Neuroscience 2020Quote: ... we drilled a small hole in the skull and injected ??nl of an AAV virus pAAV.Syn.GCaMP6f.WPRE.SV40 (AAV9; from Addgene) using a glass pipette ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Neuroscience 2022Quote: ... A small volume (0.4 μl total) of virus (AAV8-EF1α-CreOn/FlpOn-GCaMP6f (RRID:Addgene_137122, titer 6.10E+13) for Aldh1a1-iCre/Th-Flpo and VGlut2-IRES-Cre/Th-Flpo mice ...
-
bioRxiv - Cell Biology 2022Quote: ... Small hairpin RNAs (shRNA) targeting sequences for specific genes were cloned in pLKO.1-Puro vector (Addgene). Upon production by 293T cells ...
-
bioRxiv - Plant Biology 2023Quote: ... Each gRNA PCR fragment was individually assembled with Arabidopsis U6 small RNA promoter (pICSL01009::AtU6p, AddGene no. 46968) in the appropriate Level 1 vector (plCH47751 ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: P-Lenti CMV/TO SV40 small + Large T (w612-1) was a gift from Eric Campeau (Addgene plasmid # 22298). For packaging the virus ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a small ubiquitin-related modifier (SUMO) sequence known to increase soluble expression (61) derived from pDest-Sumo (Addgene #106980) (62) ...
-
bioRxiv - Molecular Biology 2023Quote: ... a small guide RNA targeting the JUN exon (TCGTTCCTCCCGTGAGAG) was cloned into pX461 (a gift from Feng Zhang, Addgene #48140) in which the Cas9 nickase allele was substituted for the wild-type Cas9 allele ...
-
bioRxiv - Neuroscience 2024Quote: ... and four small injections of a mixture of 1:20 AAV-hSyn-GCamP7f (104488-AAV9, Addgene, 1×10¹³ vg/mL) and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1 ...
-
bioRxiv - Biophysics 2024Quote: ... WT and Cnot4 Het MEFs were immortalized by infection with lentivirus made from pLenti CMV/TO SV40 small + large T vector (plasmid no. 22298; Addgene). Rosiglitazone treatment was done at 10 μM for 6 hours.
-
bioRxiv - Neuroscience 2024Quote: ... a small volume of AAV8-hSyn-DIO-hM3D(Gq)-mCherry virus (Addgene 44361, final titer 2 x 1012 pp per mL) was injected bilaterally into RSC (AP ...
-
bioRxiv - Cell Biology 2023Quote: Two small gRNA (#1-GGGGTATTTCAATCAGAAGC; #2-ACGGGAAGCGCACAGTTTAT) targeting msps genomic region were synthesized and inserted into the pCFD5 vector (74) (Addgene, Plasmid #73914) via BbsI digestion ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Neuroscience 2020Quote: ... A small (~0.5 mm) craniotomy was made and the virus AAV1.hSyn1.mRuby2.GSG.P2A.GCaMP6s.WPRSE.SV40 (Addgene 50942, titer 1.9 × 1013 vg/ml, −50 nL) was injected into the hippocampus (from bregma ...
-
bioRxiv - Molecular Biology 2023Quote: dCas9-VPR and Cas9 experiments were performed using a published multiplex four sgRNA construct system.79 The four sgRNAs for each of the sgRNA target sites (Kcnk9 TSS, E1, and E2) were cloned into four sgRNA backbones each containing different small RNA promoters (Addgene #53186, #53187, #53188, #53189). Golden Gate cloning into pLV-GG-hUbC-dsRED (Addgene #84034 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...