Labshake search
Citations for Addgene :
351 - 400 of 1125 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(chicken) is available from Addgene; #190692.
-
bioRxiv - Neuroscience 2023Quote: ... The desired region of plasmid pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) was amplified by PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293/T17 cells were transfected with DNAJB1-PRKACA K128H plasmid along with psPAX2 (Addgene plasmid #12260, gift from Didier Trono) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2021Quote: Rhodopsin protein was expressed in HEK293 cells using transient transfection (pcDNA3 rod opsin construct, a gift from Robert Lucas (Addgene plasmid # 109361 ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: HEK293 cells were transfected in 96-well plates with the 8xGTIIC-luciferase plasmid (firefly luciferase, # 34615, Addgene, Watertown, MA, US) and the pRL-SVl40P plasmid (Renilla luciferase ...
-
bioRxiv - Cell Biology 2020Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol (Tropea et al. ...
-
bioRxiv - Immunology 2022Quote: ... and a 1xHA tag was created using pSL1394 as a base plasmid (Addgene # 129522). A homology-directed repair (HDR ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol(Tropea et al. ...
-
bioRxiv - Microbiology 2020Quote: ... was replaced with PspCas13b with HIV NES and HA tag (from pC0046 (Addgene #103862)) to generate pC0068-PspCas13b-HA for PspCas13b-HA purification.
-
bioRxiv - Genomics 2022Quote: ... and either pENN.AAV.TBG.PI.N-FLAG-tag mSTAT5bCA.WPRE.bGH (see above) or pENN.AAV.TBG.PI.ffLuciferase.RBG (firefly luciferase expressed from TBG promoter; Addgene # 105538). Plasmids were mixed in a 3:1 weight ratio of total plasmid DNA:PEI in 4 mL of either OptiMeM™ (Gibco cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... into the TfR-sfGFP-myc tag-SpyCatcher003 plasmid (Keeble et al. [55]. Addgene #133451) through Gibson Assembly (primers listed in Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... SpyCatcher/Spy-tag and SUMO containing plasmids were purchased from Addgene (#133449 and #111560).
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: Mitochondrial immunoprecipitations were performed using K562 cells expressing an HA-mito tag (Addgene #83356) or a control MYC-mito tag (Addgene #83355 ...
-
bioRxiv - Cell Biology 2023Quote: The sequence coding for Halo tag was amplified from pSEMS-Halo7Tag-hFis (111136 Addgene) vector by using primers (5’-GCAATTCGATATGGGATCCGAAATCGGTACTGGCTTT CC-3’ and 5’-GGCCTCGAGATTAACCGGAAATCTCCAGAGTAG-3’).
-
bioRxiv - Cell Biology 2023Quote: ... the GFP fluorescent tags of ITGB3-GFP (gift from Jonathan Jones – Addgene plasmid #26653) and GFP-Talin1 (gift from Anna Huttenlocher – Addgene plasmid #26724 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a pcDNA3.1-based plasmid containing a C-terminal 3xFLAG-V5 tag (Addgene 87063) for all other variants ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pWPI-SLC7A11 cDNA with an HA tag was obtained from Addgene (#201643). By using Gateway cloning ...
-
bioRxiv - Immunology 2022Quote: ... pBOB-CAG-SARS-CoV2-S-HA was a gift from Gerald Pao (Addgene plasmid # 141347; http://n2t.net/addgene:141347; RRID:Addgene_141347). pCAGGS-SARS2-S-FKO (C-flag ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-TEV bacterial sequence was codon optimized (Table S2) and cloned into plasmid pET11a at NdeI/BamHI sites (synthesised and cloned by GeneWiz) (Addgene ID 169192). The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193 ...
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Smarcd2 and Ctbp2 sgRNAs were designed with the Synthego CRISPR design tool (Table S2) and cloned into a LentiCRISPRv2 vector (Addgene plasmid #52961). The lentiviruses were packaged with second-generation helper plasmids by transfection with lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned into either a Lentiviral CMV-driven construct for use in cell culture experiments (shown in Figure S2) or a GFAP-GFP Adeno-associated virus (AAV) construct (Addgene plasmid #50473) for use in animal experiments (utilized in Figure 3 and Figure 4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... self-complementary single-stranded DNA oligos (Supp Table S2) were annealed and cloned into AgeI/EcoR1 sites of Tet-pLKO-puro vector (Addgene plasmid # 21915). All constructs were validated by direct sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... The individual ORFs were then amplified by PCR using primers ZJ6-ZJ10 (Table S2) and cloned individually into a pLEW100v5 vector (pLEW100v5 was a gift from George Cross; Addgene plasmid # 24011) using Gibson assembly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... sgRNAs containing 20-nucleotide (nt) spacer sequences to direct Cas9 cleavage were encoded on donor or guide plasmids constructed from pAM041 (Figure S2, Addgene ID 217969) as described below ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: ... integrating lentivirus for both Cas9 and sgRNA was generated by overnight transfection of adherent HEK293 cells with either the Cas9 or sgRNA vector and the packaging vectors psPax (Addgene #1226) and pMD2g (Addgene #12259) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Lentiviral particles containing the CD19 CAR element were produced by lipofectamine-based co-transfection of HEK293 cells with 3rd generation packaging plasmids pMD2.G (Addgene, #12259), pMDLg/pRRE (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Neuroscience 2021Quote: ... the plasmid carrying spike protein sequence (Miaoling Plasmid Sharing Platform plasmid #P18156) was co-transfected with psPAX2 (Addgene plasmid #12260) into HEK293T cell line using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: The Extracellular domain of SARS-CoV-2 spike protein of that (GenBank: MN908947) was engineered in a pcDNA3CMV-based-plasmid as Zhou-COVID-19-Spike (Plasmid #161029, Addgene) to assemble pseudo-virus more efficiently ...
-
bioRxiv - Cancer Biology 2019Quote: ... lentiviral vector to tag the nucleus of HFF1 cells was purchased from Addgene (Plasmid #21210). Trypsin/EDTA was purchased from Thermo Fisher Scientific (R001100) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first eliminated the HA-tag in phage-UBC-NLS-HA-tdMCP-HaloTag (Addgene, 104098) and inserted IRES-tdPCP-SNAPtag-CAAX downstream of the tdMCP-HaloTag ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Genomics 2024Quote: ... GL261 cultures were partially transduced with sgRNA expression lentiviruses with a GFP tag (Addgene 187241)40 ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... see Table S2 for sequences) and cloned as oligonucleotide dimers into BsmBI-digested plentiCRISPR-v2-puro (Addgene #98290, a gift from Feng Zhang), as described previously (42).
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Genomics 2023Quote: Plasmids in the pCAG backbone used to overexpress TWIST1 and ALX4 in HEK293 cells were cloned by digesting the pCAG-NLS-HA-Bxb1 plasmid (Addgene plasmid # 51271) prepared from dam-/dcm- E ...
-
bioRxiv - Microbiology 2022Quote: ... were introduced into a previously described spike-expression plasmid containing D614G and a 21-amino-acid deletion in the cytoplasmic tail (Addgene 158762) (34) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Immunology 2019Quote: Hem1 expression constructs containing C-terminal 3xFLAG-v5 tags were generated in a pcDNA3.1 backbone (Addgene) using Gateway cloning technology (Thermo Fisher ...