Labshake search
Citations for Addgene :
351 - 400 of 1525 citations for Rnase 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50 ng/µl Peft-3::Cas9 (Addgene 46168) and 2,5 ng/µl Pmyo-2::tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746 ...
-
bioRxiv - Cell Biology 2023Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab). To generate Emerald-Rab7L8A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting chimera genes for the light chain and the His-tagged heavy chain of the Fabs were separately cloned into the pCAGEN vector (a gift from Connie Cepko (Addgene plasmid #11160)) 34 ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Biophysics 2023Quote: ... was cloned into the pEG-BacMam expression vector with the GFP and 8X-His tags at the C-terminus (Addgene: Table S2). All constructs with large domain insertions and deletions were made using standard protocols for Gibson assembly (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). This construct was co-expressed with chaperones groEL ...
-
bioRxiv - Molecular Biology 2024Quote: The human MPST expression plasmid with the N-terminal His tag with TEV cleavage site (MPSTA) was a gift from Nicola Burgess-Brown (Addgene plasmid #42482). The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340) ...
-
bioRxiv - Cell Biology 2020Quote: ... VSV-G-tagged human Lrp6 was obtained from Addgene (27282), amplified by PCR using primers containing Gateway sequences ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... Human codon optimized Cas9 nuclease (hCas9) was used (Addgene (41815)) ...
-
bioRxiv - Cell Biology 2019Quote: A human CRISPR KO Pooled Library (GeCKO v2) (Addgene, 1000000048) was used to introduce mutations in the H4-tfLC3B genome ...
-
bioRxiv - Cell Biology 2020Quote: Human PKM2 wild-type construct was purchased from Addgene (44242) and sub-cloned to pCMV-Tag2B plasmid (Agilent Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... The human TdT cDNA was cloned into CTV (Addgene #15912) construct in which the TdT expression was driven by CAG promotor and followed by a EGFP expression that mediated by an internal ribosome entry site (IRES ...
-
bioRxiv - Immunology 2022Quote: ... The human TdT cDNA was cloned into CTV (Addgene #15912) construct in which the TdT expression was driven by CAG promotor and followed by a EGFP expression that mediated by an internal ribosome entry site (IRES ...
-
bioRxiv - Biophysics 2019Quote: The human Sox2 and Oct4 genes were purchased from Addgene and the human c-Myc and Max genes were amplified from HeLa cell cDNA (US Biological T5595-0449) ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Brunello Human CRISPR knockout pooled lentiviral library (Addgene 73179) was used23 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Brunello Human CRISPR knockout pooled lentiviral library (Addgene 73179) was used (33) ...
-
bioRxiv - Genetics 2020Quote: ... we amplified human ACE2 (hACE2) from pcDNA3.1-ACE2 (Addgene 1786) and cloned it into a lentiviral transfer pLEX vector carrying the hygromycin resistance gene using Gibson Assembly Master Mix (NEB E2611L) ...
-
bioRxiv - Neuroscience 2020Quote: pET/Calmodulin construct: Untagged human calmodulin was amplified from Addgene plasmid #47603 via PCR and cloned into an empty pET/T7 expression vector (gift from H.J ...
-
bioRxiv - Cell Biology 2020Quote: Human intestinal enteroids (HIEs) were transduced with pABpuro-BluF (Addgene) plasmid DNA containing 1kb of the mouse Bmal1 promoter fused to luciferase (Bmal1-luciferase)29 ...
-
bioRxiv - Cancer Biology 2022Quote: A human SLC knockout library [40] was purchased from Addgene, (Cat ...
-
bioRxiv - Neuroscience 2022Quote: Human DAT cDNA was amplified from YFP-hDAT (Addgene, 90228) and pHluorin was amplified from vGlut1-pHluorin (a gift from Timothy A ...
-
bioRxiv - Neuroscience 2023Quote: ... For the transfection with human Pdhk1 clone (hPdhk1; Addgene: 20564). Pre-OLs after partial differentiation for 4 days from the OPCs ...
-
bioRxiv - Neuroscience 2023Quote: ... full length human TPPP (BC131506) and αSynuclein (MJFF Addgene 51486) were cloned into modified pHAT bacterial expression vectors as previously described (Fu et al ...