Labshake search
Citations for Addgene :
1 - 50 of 556 citations for Ribonuclease P Protein Subunit p38 RPP38 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925 ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene, 6085-1) by using standard Lipofectamine 3000 protocols (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biophysics 2024Quote: ... and γ subunits were gifts from Christie Thomas (Addgene plasmid # 83430 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928, http://n2t.net/addgene:17928; RRID:Addgene_17928; (Luo et al., 2002)) ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925; http://n2t.net/addgene:17925; RRID:Addgene_17925; (Luo et al., 2002)) ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-p38 produced in the laboratory of Rony Seger was purchased from Addgene (#86832). A complete list of plasmids and gene specific primers is available in supplementary Tables S4 and S5.
-
bioRxiv - Microbiology 2021Quote: ... P (Addgene # 64088), and L (Addgene # 64085 ...
-
bioRxiv - Biophysics 2023Quote: ... biotin ligase (BirA; Addgene#109424) was expressed in E ...
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the epsilon subunit of the bacterial FoF1-ATP synthase cDNA (Addgene plasmid #113906) was inserted into mTQ2-pRSET-A plasmid at Tyr-145 (between the KpnI and EcoRI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene #53755-53762). Each was subcloned into FlexiBAC SF9 expression plasmids61 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Neuroscience 2020Quote: ... p-WPXL-Sox9 (Addgene, #36979) and control plasmid p-WPXL (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... and p-VSVG (Addgene #138479). One day post- transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... p-MAC-TMPRSS4 (Addgene #172422), pDONR221-TMPRSS11D (Addgene #158447) ...
-
bioRxiv - Molecular Biology 2024Quote: ... p-hCathepsin L (Addgene #11250), pCSDest-HA-TMPRSS2 (Addgene #154963) ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Neuroscience 2020Quote: ... bacterial biotin ligase BirA-ER from Addgene #20856 was subcloned into a CFP-P2A expressing shuttle vector to form f(syn)CFP-P2A-BirA-ER ...
-
bioRxiv - Microbiology 2020Quote: ... P-EGFP-N1 (Addgene plasmid#2491) was used in transfection and nucleofection experiments as a control.
-
bioRxiv - Cell Biology 2023Quote: ... pEFIRES-P-mTagBFP-KDEL (Addgene – 87163) were purchased from Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pCMV-P-RAN-GFP136 (#106408, Addgene) and pCMV-P-RAN-RFP636 (#106411 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... 65]: CFP was inserted into the TM3-TM4 intracellular loop of the β2 subunit (Addgene, catalog #: 15106), YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... pSH-EFIRES-P-AtAFB2 (Addgene plasmid #129715)27 ...
-
bioRxiv - Neuroscience 2020Quote: ... and control plasmid p-WPXL (Addgene, #12257) were used for Sox9 overexpression and the transfection was performed by using FuGENE6 Transfection reagent (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... and pCMV-P-RAN-RFP636 (#106411, Addgene) were digested with AscI ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentiviral expression vector encoding the p38 MAPK Kinase Translocation Reporter (KTR) was a kind gift from Markus Covert (Addgene plasmid no. 59155). ON-TARGETplus SMARTpool siRNAs for the genes of interest as well non-targeting negative control siRNAs were obtained from Dharmacon (Lafayette ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Neuroscience 2020Quote: ... receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168; http://n2t.net/addgene:49168; RRID: Addgene_49168). Rat GABAAα1 (NM_183326 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 ng p-CMV-VSV-G (Addgene, 8454), 900 ng psPax2 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... 13.9 μg of SAD B19-P (Addgene #32631), 13.9 μg of SAD B19-L (Addgene #32632) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were immortalised using the catalytic subunit of hTERT delivered by transduction using a lentivirus vector (pLV-hTERT-IRES-Hygro; Addgene). Two days post-transduction ...
-
bioRxiv - Molecular Biology 2021Quote: ... Humanized Renilla luciferase reporter (p CIneo-RL; Addgene #115366) was described previously (42).
-
bioRxiv - Genetics 2023Quote: ... an EGFP p-middle entry (Addgene, Kwan, Chien lab) and rab5c p-3’entry clone (Clark et al. ...