Labshake search
Citations for Addgene :
351 - 400 of 841 citations for Recombinant Mouse Pdcd1 Protein Fc Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids for nanobody fusion protein expression are deposited with Addgene (Addgene: #109417 ...
-
bioRxiv - Genetics 2020Quote: ... R47H TREM2 or GFP proteins (Addgene; pCW57-GFP-2A-MCS, #71783). After 2-weeks of puromycin selection ...
-
bioRxiv - Cell Biology 2021Quote: Protein expression vector pET28a-mCherry-CNA35 was obtained from Addgene (#61607). Transformed E.coli (BL21 ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2021Quote: ... The fusion protein was cloned into pAAV-CAG-GFP (Addgene #37825) by substituting the GFP with H2B- mGreenLantern using restriction enzymes BamHI and XhoI ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Neuroscience 2022Quote: ... and a PCR amplicon containing the CRISPRoff-v2.1 protein from Addgene plasmid 167981 (gifted from Luke Gilbert [45] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Genomics 2021Quote: ... and Protein AG (pAG) was amplified from pAG/MNase (ASP4154, Addgene plasmid #123461 ...
-
bioRxiv - Neuroscience 2022Quote: ... and a plasmid containing the Rep/Cap proteins (Addgene Plasmid #112862) using polyethylenimine (Polysciences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Neuroscience 2023Quote: ... Fusion protein ProteinA-Tn5 was prepared in-house (plasmid Addgene #124601) by following a previously described protocol 33 ...
-
bioRxiv - Neuroscience 2024Quote: ... The chimeric Gqi9 protein was ordered from Addgene (Plasmid No. 125711). This was then further modified using PCR and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Biophysics 2021Quote: ... This vector also contains EF1α promoter for target protein expression (Addgene #65712) and puromycin resistance gene under PGK promoter for antibiotic selection of the transferred cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids coding for the following protein products were obtained from Addgene: non-fluorescent FRB-ECFP(W66A)-Giantin [# 67903 ...
-
bioRxiv - Cell Biology 2019Quote: ... RCC1 was targeted with an infra-red fluorescent protein (IFP2.0 Addgene #54785), TIR1 was targeted with 9 Myc-tag sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane scaffold protein 1D1 (MSP1D1) was expressed from the pMSP1D1 plasmid (AddGene) with an N-terminal His-tag and was purified by affinity chromatography (26).
-
bioRxiv - Biochemistry 2021Quote: ... The plasmid encoding for membrane scaffold protein MSP1D1 was purchased from AddGene.43
-
bioRxiv - Genomics 2020Quote: Tn5 was generated by the MDC Protein Production & Characterization Platform from Addgene plasmid #60240 according to76 at 1.95 mg/ml with the following minor modifications ...
-
bioRxiv - Molecular Biology 2020Quote: Protein expression constructs were obtained through the following: FLAG-N1ICD (AddGene #20183), N2ICD (#20184) ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... For LRP6 and ADAMTSL2 protein interaction studies the LRP6-pCS2 (Addgene, 27242) was used for co-transfection ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse HA-Bnip3ΔExon3 (sNip) (Accession #MF156210) were described previously (Addgene #100793) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...
-
bioRxiv - Cell Biology 2020Quote: ... we used a mouse pooled kinome CRISPR-Cas9 pooled library (#75316, Addgene) (23) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Cancer Biology 2023Quote: The mouse Genome-Scale CRISPR Knock-Out (mGeCKO) library A (Addgene #1000000052), composed of ∼68,000 gRNAs ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...