Labshake search
Citations for Addgene :
151 - 200 of 258 citations for Recombinant Mouse PGF since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244; http://n2t.net/addgene:15244; RRID:Addgene_15244). Human α3-nAChR-GFP was obtained from Sino Biological (HG29719-ACG) ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Immunology 2020Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... a gRNA targeting exon three of mouse TOM1L2 (GCTCTAAAGAAGCGGCTTAG) was cloned into pX459V2.0-eSpCas9(1.1) (gift from Yuichiro Miyaoka; Addgene; plasmid no ...
-
bioRxiv - Neuroscience 2022Quote: ... the Adamts2 or TGFβR2 coding sequence was amplified by PCR using mouse Adamts2 and TGFβR2 ORF plasmids (pCMV-Adamts2, Harvard plasmid clones; pCMV-TGFβR2, Addgene) as templates ...
-
bioRxiv - Neuroscience 2022Quote: ... and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer: 5.9×1012 GC/mL, Addgene #126941). PV mice (n=9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genetic depletion of mouse RhoA or AKT1 in vivo was conducted using pSECC (#60820; Addgene, Watertown, MA, USA), a lentiviral-based system that combined both the CRISPR system and Cre recombinase ...
-
bioRxiv - Biochemistry 2023Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663; http://n2t.net/addgene:13663 ; RRID:Addgene_13663). The mouse Src gene was subcloned into the pEGN Bacmam vector(41) ...
-
bioRxiv - Cancer Biology 2023Quote: ... male mice were injected with 6.4 X 108 GC/mouse of AAV8.TBG.PI.Cre.rBG (AAV-TBG-Cre, Addgene, 107787-AAV8) diluted in 100μL PBS via the tail vein ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... this line (148.4) was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus injections per mouse pup were in a total volume of 4μL of AAV9-syn-GCaMP6s (Addgene, MA, USA) with a titer of 1Χ1013 vg/mL ...
-
bioRxiv - Microbiology 2020Quote: The mouse cDNA sequence of filamin A from MEF cells was amplified and cloned into pcDNA3-myc plasmid (Addgene). The resulting plasmid pcDNA3- myc-FLNA was transiently transfected in the MEF cells and then the transfected cells were infected with Toxoplasma for 18 h (MOI ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Immunology 2020Quote: The targeting constructs used for introducing the in-frame mAID sequences into mouse endogenous CTCF locus (pEN84, Addgene #86230) and for introducing the OsTir1-V5 expression cassette into endogenous Rosa26 locus (pEN114 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse Sp7 and GFP lentiviruses were generated by transfecting HEK293T cells with a blasticidin resistance backbone (Addgene, plasmid 26655) along with psPAX2 and MD2.G ...
-
bioRxiv - Developmental Biology 2020Quote: The plasmid encoding for the mouse Dbx2 RNA probe was a gift from Thomas Jessell (Addgene plasmid 16288; 33). Instead ...
-
bioRxiv - Cell Biology 2020Quote: Mouse CRISPR GeCKO v2 Knockout Pooled Library (Shalem et al., 2014, Sanjana et al., 2014) was purchased from Addgene. The library was amplified according to the developer’s protocol (Shalem et al. ...
-
bioRxiv - Immunology 2021Quote: 1C metabolism gRNA library was curated by referencing the Mouse CRISPR Knockout Pooled Library (Brie) (Addgene, Pooled Library #73632) (Doench et al. ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Immunology 2020Quote: The mouse Brie CRISPR knockout pooled library (lentiCRISPRv2 backbone; a gift from David Root and John Doench (Addgene #73633) was sub-cloned into the pMX-28 retroviral vector (Fig ...
-
bioRxiv - Pathology 2022Quote: ... tdTomato-WPRE-polyA sequence was obtained from the sequence of the targeting vector for Ai9 mouse (Addgene plasmid #22799) since the Ai9 mouse shares the same sequence for tdTomato-WPRE-polyA with the Ai14 mouse used in this study29 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AMPKγ1 mutant vector wherein Ser260 and Thr262 were replaced with alanine was created using parent-template backbone mouse AMPKγ1- full-length vector (# 15996, Addgene) and primers with the desired mutation ...
-
bioRxiv - Developmental Biology 2023Quote: ... a clone of EUC313f02 NipblFLEX/+ ES cells (European Conditional Mouse Mutagenesis Program) was transfected with pCAG-Cre:GFP (Addgene #13776) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865; http://n2t.net/addgene:108865; RRID:Addgene_108865).
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The plasmid MyosinIIA-GFP [23] that encodes for mouse GFP-Myosin9 was a gift from Matthew Krummel (Addgene plasmid #38297).
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Microbiology 2021Quote: The genome-scale CRISPR-Cas9 screen was performed using the mouse GeCKOv2 sgRNA library as previously described (Fig. 1A) (Addgene) [36] ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were infected at low viral titer with the pooled mouse CRISPR lentiviral library containing 78,637 gRNAs targeting 19,674 genes (Addgene #73633-LV). Infected cells were selected with puromycin (1 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... The gene encoding mouse E1 was a kind gift from Jorge Eduardo Azevedo (Addgene plasmid 32534, (Carvalho et al., 2011)) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse SEMA6A-Fc and SEMA6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively) and human SEMA6A was gene-synthesized (GeneArt) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse Sema6a-Fc and Sema6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively). Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript) ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Genetics 2020Quote: The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
bioRxiv - Immunology 2021Quote: The lentiviral gRNA plasmid library for genome-wide CRISPR-Cas9 screen (Mouse Improved Genome-wide Knockout CRISPR Library v2, Pooled Library #67988#) and mock vector (#67974) was obtained from Addgene. The library was amplified following the protocol provided by Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.