Labshake search
Citations for Addgene :
301 - 350 of 449 citations for Recombinant Mouse Il1b None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse ULK1 cDNA was isolated from a p3xFLAG-CMV14-mULK1 vector (#24301, Addgene) by PCR and cloned into the Halo-tagged pFN21A vector (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Genetics 2023Quote: ... Codon-optimized of full-length mouse RNF212B was cloned into pET-28b (+) (Addgene) with a C-terminal 6xHis tag ...
-
bioRxiv - Microbiology 2023Quote: The Mouse Genome-wide Knockout CRISPR sgRNA Library was purchased from Addgene (#67988)5 ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525; http://n2t.net/addgene:45525; RRID:Addgene_45525), pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526; http://n2t.net/addgene:45526; RRID:Addgene_45526), and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: The truncated mouse Fzd2 gene (Fzd2-delN) was cloned from pRK5-mFzd2 (#42254, Addgene) with a 1D4 tag at the C terminus by PCR using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP and gRNAs against mouse Ampkα1 (79004) and Ampkα2 (79005) were obtained from Addgene. C2C12 cells were first transfected with Ampkα1 gRNA and sorted with GFP ...
-
bioRxiv - Genetics 2022Quote: ... mouse cGAS was amplified via PCR from a pMSCVpuro-eGFP-cGAS template (Addgene, 108675) using primers containing KpnI and NotI restriction sites (S1 Table) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene # 1000000052). To prepare lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527; http://n2t.net/addgene:45527; RRID:Addgene_45527) were gifts from Haining Zhong 73 ...
-
bioRxiv - Neuroscience 2019Quote: Mouse Rit2 (mRit2) cloned into pGEX2T was a gift from Julian Downward (Addgene plasmid #55663)[59] ...
-
bioRxiv - Cancer Biology 2019Quote: SgRNAs targeting mouse Wnt5a or Yap1 were cloned into pSpCas9(BB)-2A-Puro (Addgene, #62988) and transfected into target cells ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid for inserting transgene into mouse genome: pBT378_pattB-pCA-GFP-pA-attB plasmid (Addgene, 52554).
-
bioRxiv - Cancer Biology 2023Quote: ... GSDME-EGFP or mouse Mlh1 lentiviral vector and packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Molecular Biology 2020Quote: CRISPR–Cas9 screen was performed using genome-scale mouse Brie CRISPR knockout pooled library (Addgene #73633) 68 ...
-
bioRxiv - Immunology 2020Quote: ... we first amplified sgRNA sequences from an optimized mouse CRISPR knockout library lentiCRISPRv2-Brie (Addgene #73632). A total of eight 50 μL PCR reactions were performed to maximize coverage of sgRNA complexity ...
-
bioRxiv - Developmental Biology 2019Quote: ... MEFs were transduced with the doxycycline-inducible mouse tet-STEMCCA [27] and rtTA lentiviruses (Addgene # 20342) at an MOI of 1 ...
-
bioRxiv - Molecular Biology 2021Quote: Mouse FLAG-Sp7 or osteocrin cDNAs were introduced via lentivirus via pLX_311 backbone (Addgene, plasmid 118018) as previously described [21] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse Improved Genome-wide Knockout CRISPR Library v2 was a gift from Kosuke Yusa (Addgene #67988) (Tzelepis et al ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox9-P2A and P2A-Cre blocks were PCR-amplified from pWPXL-Sox9 (Addgene, #36979) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR(Katsuda et al. ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox4-P2A and P2A-Cre blocks were PCR-amplified from pLVXT-Sox4 (Addgene, #101121) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR31 respectively ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression vectors for mouse PDGFRα and PDGFRβ were generated from pcDNA5FRT-EF-Pdgfra-EGFPN (Addgene #66787) and pcDNA5FRT-EF-Pdgfrb-EGFPN (Addgene #66787) ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Microbiology 2020Quote: ... the mouse cDNA sequence of IRE1 from MEF cells was inserted into pcDNA3- EGFP plasmid (Addgene #13031), resulting in fusion proteins with the EGFP fused to the carboxy terminus of IRE1 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse Neurexin3α-(-S4) (cDNA gift from Ann Marie Craig’s lab) and rat Neurexin3β-(-S4) (cDNA from Addgene plasmid #58269 from Peter Scheiffele’s lab) ...
-
bioRxiv - Developmental Biology 2019Quote: SAM mouse embryonic stem cells (ESCs) were generated by lentiviral transduction of lenti dCas9-VP64_Blast (Addgene 61425) and lenti MS2-p65-HSF1_Hygro (Addgene 61426 ...
-
bioRxiv - Systems Biology 2019Quote: ... and Dnmt3L KI cells were transduced with the Mouse CRISPR Knockout Pooled Library (GeCKO v2) (Addgene, # 1000000052) [48] via spinfection as previously described ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse SMO (gift from Gregory Pazour, UMass, Worcester, USA; plasmid no. 164532; Addgene (Desai et al., 2020)) ...
-
bioRxiv - Immunology 2022Quote: ... Mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633). The plasmid DNA pool was amplified as previously described (Doench et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We utilized a well-functioning and validate genome-wide mouse lentiviral CRISPR guide RNA library v2 (Addgene). It consists of 90230 gRNA sequences directed against 18424 different genes across the mouse genome ...
-
bioRxiv - Microbiology 2022Quote: Mouse Brie CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73633) (42 ...
-
bioRxiv - Immunology 2023Quote: Mouse naïve CD4+ T cells were transfected with C1-MPAct-mCherry (Addgene #155222, gift from Tobias Meyer) and C1-eGFP-CaaX (Addgene #86056 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The mouse Sik3 cDNA purchased from GE Dharmacon (Clone ID: 6515742) was cloned into a LentiV_Neo vector (Addgene_108101) using In-Fusion cloning system (Clontech) ...
-
bioRxiv - Immunology 2021Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244; http://n2t.net/addgene:15244; RRID:Addgene_15244). Human α3-nAChR-GFP was obtained from Sino Biological (HG29719-ACG) ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Immunology 2020Quote: The mouse BRIE knockout CRISPR pooled library was a gift of David Root and John Doench (Addgene #73633) (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... a gRNA targeting exon three of mouse TOM1L2 (GCTCTAAAGAAGCGGCTTAG) was cloned into pX459V2.0-eSpCas9(1.1) (gift from Yuichiro Miyaoka; Addgene; plasmid no ...