Labshake search
Citations for Addgene :
151 - 200 of 635 citations for Recombinant Mouse HCFC2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Biophysics 2021Quote: ... This vector also contains EF1α promoter for target protein expression (Addgene #65712) and puromycin resistance gene under PGK promoter for antibiotic selection of the transferred cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids coding for the following protein products were obtained from Addgene: non-fluorescent FRB-ECFP(W66A)-Giantin [# 67903 ...
-
bioRxiv - Cell Biology 2019Quote: ... RCC1 was targeted with an infra-red fluorescent protein (IFP2.0 Addgene #54785), TIR1 was targeted with 9 Myc-tag sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane scaffold protein 1D1 (MSP1D1) was expressed from the pMSP1D1 plasmid (AddGene) with an N-terminal His-tag and was purified by affinity chromatography (26).
-
bioRxiv - Biochemistry 2021Quote: ... The plasmid encoding for membrane scaffold protein MSP1D1 was purchased from AddGene.43
-
bioRxiv - Genomics 2020Quote: Tn5 was generated by the MDC Protein Production & Characterization Platform from Addgene plasmid #60240 according to76 at 1.95 mg/ml with the following minor modifications ...
-
bioRxiv - Molecular Biology 2020Quote: Protein expression constructs were obtained through the following: FLAG-N1ICD (AddGene #20183), N2ICD (#20184) ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... For LRP6 and ADAMTSL2 protein interaction studies the LRP6-pCS2 (Addgene, 27242) was used for co-transfection ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse HA-Bnip3ΔExon3 (sNip) (Accession #MF156210) were described previously (Addgene #100793) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...
-
bioRxiv - Cell Biology 2020Quote: ... we used a mouse pooled kinome CRISPR-Cas9 pooled library (#75316, Addgene) (23) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Cancer Biology 2023Quote: The mouse Genome-Scale CRISPR Knock-Out (mGeCKO) library A (Addgene #1000000052), composed of ∼68,000 gRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Biochemistry 2023Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663 ...
-
bioRxiv - Physiology 2024Quote: ... (1.3 × 1011 plaque-forming units per mouse, ((107787-AAV8, Addgene, Watertown, MA)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse PSD95 sequence was a gift from Gary Bassell (Addgene plasmid #102949). TurboID was fused at the C-terminus of PSD95 and inserted into a cre-dependent AAV expression vector under the synapsin promoter by Gibson assembly (NEB) ...
-
bioRxiv - Plant Biology 2019Quote: ... Green fluorescent protein (GFP) from the Gateway entry vector pENTR4-GFP-C1 (Addgene) was transferred to pYES-DEST52 and pAG426GAL-ccdb using Gateway LR Clonase ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat (DR ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861, PspCas13b: Addgene 103862, RfxCas13d: Addgene 109049) and their direct repeat (DR ...
-
bioRxiv - Molecular Biology 2019Quote: ... The nanodisc scaffold protein MSP1D1 was expressed and purified using pMSP1D1 (Addgene #20061) as described previously (Denisov et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Retrograde adeno associated viruses encoding green fluorescent protein (Addgene, Catalog number 50465-AAVrg) or tdtomato (Addgene ...
-
bioRxiv - Physiology 2021Quote: ... Fluorescent protein sequences were PCR-derived from pmVenus(L68V)-mTurquiose2 (Addgene plasmid #60493), Gamillus/pcDNA3 (Addgene plasmid #124837) ...
-
bioRxiv - Cell Biology 2020Quote: ... SpCas9 protein generated from the expression plasmid pET-NLS-Cas9-6xHis (Addgene #62934) was purified according to (Zuris et al. ...
-
bioRxiv - Developmental Biology 2021Quote: DR274 gRNA plasmids and Cas 9 protein were from Addgene (Cambridge Massachussets, USA) and New England Biolabs (Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pcDNA3-YFP (for YFP protein) was a gift from Doug Golenbock (Addgene plasmid #13033 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Systems Biology 2023Quote: ... and to amplify the fluorescent proteins from plasmids (SYFP2 from pSYFP2-C1 Addgene #22878 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNAs were subcloned into the pMSCV-IRES-green fluorescence protein vector (Addgene #20672) with reference to a report by Masubuchi et al.43 The constructed plasmid was validated by sequencing prior to use.
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Genomics 2024Quote: ... the expression plasmids (pRha-ABE8e-NRCH, Addgene #165417; and pABE8e-protein, Addgene #161788) were transformed into BL21Start DE3 competent cells (Thermo) ...
-
bioRxiv - Cancer Biology 2024Quote: Pre-Intact clone was infected with pLV-Azurite (blue fluorescent protein, Addgene, 36086) and Pre-ARSIR1 clone was infected with SGEP-Renilla-713 (GFP ...
-
bioRxiv - Microbiology 2021Quote: ... lentivirus that harbored the mouse GeCKOv2 sgRNA library in the lentiCRISPRv2 vector (Addgene) was produced in HEK293FT cells (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... GFP-PGC1 plasmid expressing eGFP-tagged mouse PGC1a was acquired from Addgene(50). For in vivo electroporation ...
-
bioRxiv - Neuroscience 2021Quote: ... one DATcre mouse was injected with AAV8-hSyn-DIO-mCherry (Addgene, cat#50459) in midbrain (SNc ...