Labshake search
Citations for Addgene :
51 - 100 of 636 citations for Recombinant Mouse Epo Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Cell Biology 2023Quote: After production of recombinant lentiviruses in HEK293T cells by co-transfection of the pLentiCRISPRv2 constructs with pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein and mRNA (44758; Addgene) were co-microinjected into zygotes [F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J] using the reagent concentrations listed in Table S1 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... The recombinant WNK1 kinase domain was eluted via addition of 50 nM bdSENDP1 protease (Frey et al., 2014; Addgene ID 104962) in wash buffer 4.
-
bioRxiv - Biochemistry 2022Quote: ... For expression of recombinant drosophila c-Src isoform 42A (Src42A, UniProtKB Q9V9J3) we used a pET-His10-Src42A plasmid (Addgene #126674) codifying a full-length drosophila isoform (aa 1-517 ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Bioengineering 2021Quote: ... We acquired psPAX2 encoding lentiviral packaging proteins and PMD2.G encoding a lentiviral envelop protein from Addgene (plasmid no ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Neuroscience 2021Quote: Pyramidal cell imaging experiments were performed by injecting a recombinant adeno-associated virus (rAAV) encoding GCaMP6f (rAAV1-Syn-GCaMP6f-WPRE-SV40, Addgene/Penn Vector Core) into male wild-type mice.
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Physiology 2022Quote: ... EGFP-DCTN1 fusion protein (Addgene pEGFP-p150Glued, #36154) or tdTomato-EB3 fusion protein (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: Plasmid pT7-7 α-Syn A53T for the expression and purification of recombinant α-Syn was a gift from Hilal Lashuel (Addgene plasmid #10572784) and EGFP-α-SynA53T plasmid for α-Syn expression in HEK293T and SH-SY5Y cells was a gift from David Rubinsztein (Addgene plasmid #4082385)).
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999) (Voigt et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid: 104999) (Voigt et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The tandem PCP (tdPCP) protein was derived from Addgene plasmid #40650 ...
-
bioRxiv - Bioengineering 2020Quote: ... pMD2.G containing VSV-G envelop protein (Addgene, #12259) and pCMVΔR8.2 (Addgene ...