Labshake search
Citations for Addgene :
501 - 550 of 580 citations for Recombinant Mouse Egfl7 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... tdTomato-WPRE-polyA sequence was obtained from the sequence of the targeting vector for Ai9 mouse (Addgene plasmid #22799) since the Ai9 mouse shares the same sequence for tdTomato-WPRE-polyA with the Ai14 mouse used in this study29 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AMPKγ1 mutant vector wherein Ser260 and Thr262 were replaced with alanine was created using parent-template backbone mouse AMPKγ1- full-length vector (# 15996, Addgene) and primers with the desired mutation ...
-
bioRxiv - Molecular Biology 2023Quote: More than 140 million wild type Abl pre-B cells carrying inducible Cas9 transgene were transduced with a lentiviral gRNA library containing 90,230 gRNAs targeting over 18,000 mouse genes (Addgene, 67988) by spin-infection as described above ...
-
bioRxiv - Developmental Biology 2023Quote: ... a clone of EUC313f02 NipblFLEX/+ ES cells (European Conditional Mouse Mutagenesis Program) was transfected with pCAG-Cre:GFP (Addgene #13776) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse vsv-plexin-B3 and human pECE-M2-BAIAP2 (IRSP53-Flag) were purchased from Addgene (#68038, #68039, #31656, USA).
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs targeting luciferase or mouse Nr1h3 and Rara were cloned into the pLKO.1 vector (Addgene, MA, USA, #8453). The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865 ...
-
bioRxiv - Biophysics 2024Quote: ... pET3a aSyn murine plasmid containing a gene encoding mouse α-synuclein was a gift from Gabriele Kaminski Schierle (Addgene plasmid # 108865; http://n2t.net/addgene:108865; RRID:Addgene_108865).
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The plasmid MyosinIIA-GFP [23] that encodes for mouse GFP-Myosin9 was a gift from Matthew Krummel (Addgene plasmid #38297).
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Microbiology 2021Quote: The genome-scale CRISPR-Cas9 screen was performed using the mouse GeCKOv2 sgRNA library as previously described (Fig. 1A) (Addgene) [36] ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were infected at low viral titer with the pooled mouse CRISPR lentiviral library containing 78,637 gRNAs targeting 19,674 genes (Addgene #73633-LV). Infected cells were selected with puromycin (1 μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... The gene encoding mouse E1 was a kind gift from Jorge Eduardo Azevedo (Addgene plasmid 32534, (Carvalho et al., 2011)) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Immunology 2020Quote: ... The donor plasmid (pW290) used to target the endogenous mouse Wapl locus was constructed by modifying a published pMK290 plasmid (Plasmid #86230, Addgene). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse SEMA6A-Fc and SEMA6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively) and human SEMA6A was gene-synthesized (GeneArt) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse Sema6a-Fc and Sema6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively). Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript) ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Genetics 2020Quote: The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
bioRxiv - Immunology 2021Quote: The lentiviral gRNA plasmid library for genome-wide CRISPR-Cas9 screen (Mouse Improved Genome-wide Knockout CRISPR Library v2, Pooled Library #67988#) and mock vector (#67974) was obtained from Addgene. The library was amplified following the protocol provided by Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Immunology 2022Quote: ... SpCas9-expressing Nrp1-/- NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2023Quote: Wild type (WT) and mutant variants of mouse p38γ were cloned into a pULTRA plasmid,42 a gift from Malcolm Moore (Addgene plasmid no ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... heterozygous Adora2a-Cre mouse neonates were injected bilaterally with the Cre-recombinase-dependent viral vectors AAV5-hSyn- DIO-hM4D-mCherry virus (Addgene Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of mouse ARNTL was synthesized (Twist Biosciences) and cloned into the NheI site of FUW-TetO-MCS (Addgene plasmid #84008 ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Cancer Biology 2021Quote: We generated pX330 Mettl3 vector by cloning the previously described sgRNA targeting mouse Mettl316 into the pX330 plasmid (Addgene Plasmid #42230). The pX330 plasmid was digested using BbsI and a pair of partially complementary annealed oligos containing overhangs from BbsI site and Mettl3 sgRNA sequence were cloned scarlessly into the vector ...
-
bioRxiv - Cell Biology 2020Quote: For derivation of HA-Smo and Smo-HA ESCs mouse Smo was amplified by PCR from the pGEN-mSmo (Addgene, #37673) and introduced in the PB-HA-IRES-Neo vector ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... Reprogramming was carried out by transducing MEFs with a doxycycline-inducible mouse OKSM (pHAGE2-tetO-STEMCCA)(Sommer et al., 2009) and rtTA (FUdeltaGW-rtTA, Addgene 19780)(Maherali et al. ...
-
bioRxiv - Biophysics 2021Quote: ... HeLa cells were stably engineered to display a doxycycline-inducible GFP fused to a mouse CD80 transmembrane domain using standard second-generation lentivector production protocols and the plasmids pMD2G (Addgene 12259), pCMVR8.74 (Addgene 22036) ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Cell Biology 2020Quote: DNA templates used for in vitro transcription of mouse Xist RNA were amplified from sequence verified plasmid pCMV-Xist-PA (Wutz and Jaenisch, 2000) (Addgene 26760), containing the murine Xist gene using high-fidelity Platinum® pfx DNA polymerase (Invitrogen™) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Cell Biology 2022Quote: The S1R-Apex construct was generated by cloning a gene synthesized product containing the cDNA sequence for mouse S1R into the pCDNA3_Sec61B-V5-APEX2 vector (Addgene plasmid 83411) (67) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904 ...
-
bioRxiv - Immunology 2019Quote: ... The PresentER plasmid encoding a signal peptide from Mouse Mammary Tumor Virus envelope protein followed by the SIINFEKL epitope followed by mCherry was obtained from Addgene (#102945),a kind gift of D ...
-
bioRxiv - Developmental Biology 2020Quote: ... Constitutive active form of mouse ChREBP was subcloned into pMSCVhyg-3xT7 to generate pMSCVhyg-3xT7-CA-ChREBP using full length clone as templates (Addgene #39235). All plasmids were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2021Quote: ... The Cherry Brie pooled CRISPR library was obtained by Gibson assembly cloning to place the sgRNA sequences form the Mouse Brie CRISPR knockout pooled library (a gift from David Root and John Doench (Addgene #73633)) into the LentiGuide-Cherry plasmid (Supplementary Figure 1A) ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression construct for mouse MLXIPL was generated by PCR-amplification from a template plasmid (from the laboratory of Isabelle Leclerc, Addgene #39235) and cloned into pcDNA3 with an N-terminal FLAG epitope tag by Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV expressing GCaMP6f under the control of the GABAergic neuron-specific enhancer of the mouse Dlx (mDlx) gene (Addgene# 83899-AAV1) (124) ...