Labshake search
Citations for Addgene :
251 - 300 of 1081 citations for Recombinant Human S100A3 His & MBP tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant SidK1-278 encoded by plasmid pSAB35 (Addgene plasmid #175787) was expressed in E ...
-
bioRxiv - Bioengineering 2020Quote: An HSA expression plasmid was obtained from Addgene (ALB-bio-His, Plasmid #52176). E400R and K383D point mutations were introduced to the HSA sequence by the Q5 site-directed mutagenesis kit ...
-
bioRxiv - Biochemistry 2023Quote: ... A plasmid expressing His-TEV-ubiquitin G76C was acquired from Addgene (Watertown, MA) and the protein was purified using Talon beads (Takara Bio Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: The plasmid pet28a-His6-Keap1 for expressing His-KEAP1 was purchased from Addgene (a gift from Yimon Aye ...
-
bioRxiv - Cell Biology 2023Quote: ... AsCas12a/AsCpf1 protein was purified as described47 from an expression plasmid generated by deleting the MBP sequence from plasmid pDEST-hisMBP-AsCpf1-EC (Addgene plasmid # 79007) transformed into Rosetta(DE3)pLysS Competent Cells (Novagen) ...
-
bioRxiv - Biochemistry 2023Quote: ... and inserted into two model DARPins: 1) 3G124 (anti-GFP) and 2) and Off7 (anti-MBP) and cloned into a pET vector (Addgene plasmid #29666) containing a N-terminal His-Tag ...
-
bioRxiv - Molecular Biology 2024Quote: The ORF of INTS6 was cloned into plasmid 438C (pFastBac His6 MBP Asn10 TEV cloning vector with BioBrick Polypromoter LIC subcloning, Addgene plasmid #55220). Constructs 438B-INTS3 ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were co-transfected with plasmid encoding mCherry-tagged Parkin (31) (Addgene plasmid #23956;) and encoding either ABCB-ChR2-YFP or ABCB-YFP using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with a plasmid encoding the GST-tagged domain of Rhotekin (Addgene plasmid # 15247). Cells were cultivated in Terrific broth (TB ...
-
bioRxiv - Cell Biology 2021Quote: ... the GST-tagged anti-GFP nanobody construct in pGEX-6P-1 vector (Addgene ID # 61838) was transformed to BL21 RIL (DE3 ...
-
bioRxiv - Genomics 2022Quote: ... and cloned into a lentivirus-based sgRNA vector tagged with GFP (Addgene plasmid no. 65656). Cas9-expressing T-ALL cell lines were transduced with sgRNA library virus at a low MOI (∼0.3) ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Microbiology 2024Quote: Triple FLAG-tagged Vpr and Vpx lentiviral expression vectors for HIV-2RODVpx (Addgene plasmid #115816), SIVSAB-92018Vpr (Addgene plasmid #115822) ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used in generating recombinant SA11 rotaviruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VP1SA11 ...
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Biophysics 2019Quote: ... human DCX (Addgene #83928), mouse DCLK1 (Transomics #BC133685) ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Cell Biology 2020Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol (Tropea et al. ...
-
bioRxiv - Bioengineering 2019Quote: ... TGFB1-bio-His (proTGFβ) which was a gift from Gavin Wright (Addgene plasmid # 52185) [17] and HA-OVOL2 (OVOL2 ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol(Tropea et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... pET29b-IPP1-His was a gift from Sebastian Maerkl & Takuya Ueda (Addgene plasmid # 124137). 15µL of Lemo21(DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 into a His-SUMO-TEV (HST) plasmid backbone (Addgene product number: 48313). Each HST construct was grown in LB to an OD600 of 0.4 at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Cancer Biology 2021Quote: Plasmid RB-GFP FL for expression of GFP-tagged RB was obtained from Addgene (Catalog #16004). For ectopic gene expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 ng reference reporter (pcDNA3.1-Nanoluc-3xFLAG-V5) and 50 ng 3xFLAG tagged constructs (Addgene #87063). Transfection was carried out using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... iEC-ESCs and iHUF cells were tagged with Azurite blue using pLV-Azurite (Addgene plasmid 36086). Lentiviral transductions were performed according to manufacturers’ protocols and successfully tagged cells were further sorted on a Beckman Coulter MoFlow Astrios (Indianapolis ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for eGFP-tagged SpvB(Salmonella SpvB 375-591) sequence were obtained from Addgene (#89446) and cloned into the pMSCV-puro vector.
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Cell Biology 2022Quote: ... pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HALO-tagged version of this plasmid was created by replacing eGFP with NGFR (Addgene plasmid 27489) using Gibson assembly (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP-tagged Gephyrin-FingR was a gift from Don Arnold (Addgene plasmid #46296 (Gross et al., 2013)) ...
-
bioRxiv - Neuroscience 2019Quote: ... the DNA cassette encoding KASH-tagged EGFP (EGFPKASH) (16) was amplified from the PX552 plasmid (Addgene #60958) by Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Genetics 2020Quote: ... FLAG-tagged PALB2 was a gift from Daniel Durocher (pDEST-FRT/T0-FLAG-PALB2, plasmid #71114, Addgene)30 ...
-
bioRxiv - Physiology 2019Quote: ... as were plasmids for recombinant production of PGC-1α (Addgene #1028 and 1029) (Puigserver et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant lentiviral particles were produced using a protocol provided by the manufacturer (Addgene). In brief ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...