Labshake search
Citations for Addgene :
351 - 400 of 1460 citations for Recombinant Human S100 Calcium Binding Protein A9 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: The vector for V5-tagged active WNT11 was a gift from Xi He (Addgene plasmid #43824; http://n2t.net/addgene:43824; RRID:Addgene_43824)23 ...
-
bioRxiv - Cancer Biology 2020Quote: Expression plasmid encoding N-terminally Flag-tagged hFOXO1-3A (#13508) was purchased from Addgene (Cambridge, MA, pCDNA3 backbone). FOXO1-3A has Ala residue substitutions at Thr-24 ...
-
bioRxiv - Immunology 2021Quote: ... Monomeric MBP-tagged NLRP3NACHT-LRR (aa 134-1034) was subcloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863) with addition of N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2024Quote: ... and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367; http://n2t.net/addgene:15367; RRID:Addgene_15367)(59)] expression vectors ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae ATCC 10031 was used for the OMVs purification. K. pneumoniae was transformed using the calcium chloride method with pGR (K. pneumoniae-pGR) (Addgene, Massachusetts, USA) and PRM-GFP (K ...
-
bioRxiv - Neuroscience 2020Quote: ... Viral vector stocks were produced by calcium phosphate transfection of 293FT cells in combination with packaging vectors psPAX2 (a generous gift from Didier Trono; Addgene plasmid # 12260) for lentiviral constructs ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, 12259) and pTAT (kind gift of P ...
-
bioRxiv - Neuroscience 2020Quote: ... Syn-driven GCaMP6f as a calcium sensor was delivered to neurons via AAV1 viral vector transfection (Addgene 100837-AAV1, 1E10 vp/dish) at 4 days in vitro ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Neuroscience 2023Quote: ... Syn-driven GCaMP6f as a calcium sensor was delivered to neurons via AAV1 viral vector transfection (Addgene 100837-AAV1, 1E10 vp/ dish) at 4 days in vitro ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 million hPSCs were transfected with either 400ng WRE plasmid with active TCF binding sites (Addgene, 12456) or MRE plasmid with mutated TCF binding sites (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant Lentiviral Vector encoding Myoc Y437H was constructed from plasmids pLentCMV-GFP(Addgene 17448)(Campeau et al. ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Cancer Biology 2020Quote: The lentiviral construct containing a truncated version of 53BP1 tagged with mApple was a gift from Ralph Weissleder (Addgene plasmid # 69531 ...
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... pcDNA3-based plasmids encoding FLAG-tagged wild type and SATA (S939A/T1462A)-mutant TSC2(51) were obtained from Addgene. The TSC2-5A (S939A ...
-
bioRxiv - Neuroscience 2022Quote: ... The AU1-tagged wild-type and two mutant (S2215Y and R2505P) mTOR constructs were gifts from Fuyuhiko Tamanoi (Addgene) 59 ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... A retrograde GFP-tagged adeno-associated virus rAAV2/1-retro (retrograde AAV-CAG-GFP; serotype “retro”, Addgene, Cat. # 37825) was pressure injected into M2 (170 ...
-
bioRxiv - Molecular Biology 2023Quote: All-in-one lentiviral plasmids for Dox-inducible expression of UNK without GFP in HeLa cells were created by insertion of the Flag-HA-tagged full-length WT or mutant UNK amplified from the corresponding entry vector into the pLIX_403 plasmid (Addgene_41395) between NheI and AgeI sites ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... The mitochondrial (CMV-mitoCAR-GECO1) and endoplasmic reticulum (CMV-ER-LAR-GECO1) targeted calcium biosensors were gifts from Robert Campbell (Addgene #46022 and #61244)(37,38 ...
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Biochemistry 2019Quote: ... and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively active glycogen synthase kinase-3β (GSK-3β) (S9A) (pcDNA3-GSK3β, # 14754, RRID: Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP tagged WT tau by golden gate assembly (pRK5-iRFP-tau ...
-
bioRxiv - Cancer Biology 2021Quote: ... and after selection in 300 μg/ml G418 cells were tagged with luciferase by transduction with lentiviruses expressing pFU-Luc2-eGFP (Addgene).
-
bioRxiv - Cancer Biology 2022Quote: ... were purchased from Horizon Discovery while the lentiviral vectors expressing scrambled shRNA (Sarbassov et al., 2005) and flag-tagged DPYD (Shaul et al., 2014) were bought from Addgene Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... GFP and GFP-tagged K19 WT and mutantconstructs were cloned from pEGFP-C3 K19 constructs into pLenti CMV Hygro (plasmid #17484. Addgene) using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... were chromosomally tagged with YFP using the mini-Tn7 system 41 (Plasmid pUC18T-mini-Tn7T-Gm-eyfp and pTNS1, Addgene plasmid # 65031 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... XPA-KO HaCaT cells stably expressing Flag-tagged XPA were generated by transfecting cells with pcDNA4-Flag-XPA (Addgene #22895) and then selecting single clones with geneticin ...
-
bioRxiv - Molecular Biology 2023Quote: Stimulated emission depletion microscopy was performed on U2OS cells transduced with lentivirus expressing Flag-tagged PREPL cDNA (pCIG3, Addgene #78264). Cells were seeded 3 days post-transduction on coverslips (thickness #1.5H ...
-
bioRxiv - Biochemistry 2023Quote: Dephosphorylated AurA (residues 122-403, TEV-cleavable, N-terminal His6-tagged, kanamycin-resistance) in pET28a and LPP (#79748) from Addgene were cotransformed in BL21(DE3 ...