Labshake search
Citations for Addgene :
351 - 400 of 2297 citations for Recombinant Human Neuropilin 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... mice were generated by subcloning an N-terminal 3x HA-tagged CIC-DUX4 fusion gene from Yoshimoto et al.6 into a Rosa26 targeting construct (Addgene #21714). The sequence verified construct was then transfected into ES cells and selected in G418 media ...
-
bioRxiv - Molecular Biology 2023Quote: pLEX-FLAG-Cre-GFP was generated by cloning PCR-amplified N-terminal FLAG tagged Cre-GFP (from pCAG-Cre-GFP; Addgene #13776) (Forward primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... we cloned N-terminally StrepII-tagged JetA (C36A, C355A) and untagged JetB into UC Berkeley Macrolab vector 13S-A (Addgene # 48323). To generate truncated JetA constructs ...
-
bioRxiv - Microbiology 2021Quote: ... pRSET his-eGFP [76] was used as a backbone and was a gift from Jeanne Stachowiak (Addgene plasmid # 113551). Wild-type IDR was PCR amplified from a full-length PEMV2 infectious clone ...
-
bioRxiv - Neuroscience 2021Quote: ... and retrograde AAV encoding Cre recombinase (AAVretro-hSyn-HI-eGFP-Cre (titer 1.17 x 1013 GC/ml, Addgene 105540) were stereotaxically injected into S2 or M1 and nwS1 ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid pBAD-His-6-Sumo-TEV-LIC cloning vector (8S) was a gift from Scott Gradia (Addgene plasmid 37507). The plasmid was modified via restriction enzyme digestion (final construct ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611; http://n2t.net/ addgene:145611; RRID: Addgene_145611). pGBWm4046852 (coding for full- length nsp8 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584; http://n2t.net/ addgene:145584; RRID: Addgene_145584). The pET-28a-nsp9 gene was obtained from BEI Resources (NR-53501) ...
-
bioRxiv - Biophysics 2019Quote: ... This α-actinin1-SNAP-His fragment was introduced downstream of the T7 promoter of pET T7-7 plasmid (Addgene).
-
bioRxiv - Biochemistry 2020Quote: The MSP1E3D1 plasmid (with a His-tag as well as a TEV protease cleavage site, from Addgene, MA, USA) (26 ...
-
bioRxiv - Neuroscience 2024Quote: ... the CaMPARI2 gene (1446 bp) was subcloned from pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 (Addgene 101060, gift from Eric Schrieter)26 into a lentiviral plasmid (pRT050 ...
-
bioRxiv - Cell Biology 2023Quote: ... Mis18BP120-130 was cloned in pEC-K-3C-His-GST and pET His6 MBP TEV (9C Addgene plasmid #48286).
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Neuroscience 2021Quote: Heterologous expression of human NaV1.2 WT (Addgene #162279)(DeKeyser et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Biophysics 2020Quote: ... we overexpressed lamin A by transiently transfecting the intact cells with m-Cherry tagged plasmid DNA for lamin A which was a gift from Michael Davison (Addgene, plasmid # 55068). To surpass lamin A expression ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Genomics 2020Quote: ... Mediator and PIC components were tagged with 3xFLAG using pFA6a-6xGLY-3xFLAG-hphMX4 (Funakoshi and Hochstrasser, 2009) (a gift from Mark Hochstrasser, Addgene plasmid #20755) or a derivative thereof in which the hphMX4 marker is replaced with a TRP1 cassette (pGZ392) ...
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Molecular Biology 2019Quote: CRISPR-Cas9-mediated generation of endogenously tagged lines was through injection of pU6-BbsI-chiRNA plasmids (Addgene:466294; (Gratz et al., 2013)) along with pBS donor plasmids containing 1 kb long homology arms into act-Cas9 embryos (Bloomington stock ...
-
bioRxiv - Biochemistry 2021Quote: ... and mouse cDNA sequences for GFP-tagged ENAH, VASP, and EVL (gifts from Frank Gertler, MIT) were sub-cloned into the pCIB lentiviral expression vector (Addgene plasmid #120862) as previously described (Puleo et al ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2000 ng total plasmid DNA per dish including the 50-1000 ng FP-tagged encoding plasmids supplemented with an empty plasmid vector (pCAG-FALSE, Addgene plasmid #89689) depending on the aimed fluorescence level [35] ...
-
bioRxiv - Cell Biology 2021Quote: ... Atg18 and CSC have been C-terminally tagged with either Gly6-FLAG3::kanMX4 (available on Addgene #20754; Funakoshi et al Yeast. 2009), yomCherry::kanMX4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pBABE-CXCL12α and pBABE-CXCL12γ were constructed by inserting CXCL12α or CXCL12γ cDNA containing C-terminally C9-tagged (TETSQVAPA) sequences into pBABE-puro (Addgene plasmid # 1764). Lentiviral and retroviral particle production and transduction were performed as described before29.
-
bioRxiv - Immunology 2022Quote: ... pTRIPZ-puro-HA-Ub was generated by Gibson assembly by PCR amplification of HA-tagged ubiquitin gene from the plasmid HA-Ubiquitin which was a gift from Edward Yeh (Addgene plasmid # 18712) and pTRIPZ-puro digested with AgeI and XhoI ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were then transformed into the strains to enable detection of MS2 and PP7-tagged mRNAs The MS2 and PP7 tagging reagents were gifts from Jeff Gerst and Robert Singer (Addgene #31864 & #35194) (Haim-Vilmovsky and Gerst ...
-
bioRxiv - Cell Biology 2021Quote: ... ATM knockout C20 lines were generated using the AIO-GFP vector encoding GFP-tagged SpCas9(D10A) nickase (kind gift of Steve Jackson; Addgene plasmid #74119) (66 ...
-
bioRxiv - Cell Biology 2023Quote: MDCK cells expressing GFP-Rab19 on the Rab19 KO background were lysed and incubated with GST-tagged anti-GFP nanobody (recombinantly produced from pGEX6P1-GFP-Nanobody, Addgene Plasmid #61838) or with free GST for negative control ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for preparation of short constructs as well as egfp-tagged constructs in pHis17 vector (Addgene plasmid #78201) by restriction-free (RF ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified human KEAP1 and LKB1 off of human cDNA and used Gibson assembly to replace GFP in pMCB306 (Addgene #89360) with these sequences ...
-
bioRxiv - Biophysics 2024Quote: Human RING1b (Uniprot ID Q99496) and human BMI1 (Uniprot ID P35226) were cloned into a pFBOH-mhl vector (Addgene plasmid # 62304) cleaved with BseRI using Gibson Assembly® Master Mix (NEB #E2611L ...